Incidental Mutation 'R6729:Olfr464'
ID529982
Institutional Source Beutler Lab
Gene Symbol Olfr464
Ensembl Gene ENSMUSG00000060787
Gene Nameolfactory receptor 464
SynonymsMOR240-2, GA_x6K02T2PAEV-9555122-9554181
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R6729 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location87913268-87920967 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 87914850 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 19 (Q19*)
Ref Sequence ENSEMBL: ENSMUSP00000149264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074874] [ENSMUST00000216461] [ENSMUST00000217112]
Predicted Effect probably null
Transcript: ENSMUST00000074874
AA Change: Q19*
SMART Domains Protein: ENSMUSP00000074415
Gene: ENSMUSG00000060787
AA Change: Q19*

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 4.3e-42 PFAM
Pfam:7tm_1 41 287 3.8e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214754
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215062
Predicted Effect probably null
Transcript: ENSMUST00000216461
AA Change: Q19*
Predicted Effect probably null
Transcript: ENSMUST00000217112
AA Change: Q19*
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,188,601 probably null Het
Acad12 A T 5: 121,607,935 H230Q probably damaging Het
AI182371 G T 2: 35,084,705 probably benign Het
Ank3 T C 10: 69,808,925 V73A probably damaging Het
Apbb1 A T 7: 105,565,381 M28K probably damaging Het
Atp6v1f A G 6: 29,467,965 D50G probably benign Het
Cdkal1 G A 13: 29,474,695 T356M probably damaging Het
Clca1 A G 3: 145,005,966 I756T probably damaging Het
Cyp17a1 A G 19: 46,670,581 V207A probably benign Het
Dnah7c A G 1: 46,672,521 E2636G possibly damaging Het
Gm13090 A T 4: 151,089,628 probably benign Het
Nceh1 T A 3: 27,241,271 L227* probably null Het
Nedd9 A G 13: 41,315,802 M625T probably damaging Het
Olfr1426 T A 19: 12,088,496 M99L probably benign Het
Olfr148 A T 9: 39,613,773 M69L probably benign Het
Olfr920 A G 9: 38,755,828 I47V probably benign Het
Pcsk4 T C 10: 80,325,101 N297S probably damaging Het
Psg21 T A 7: 18,652,591 I157F probably damaging Het
Rabep2 T C 7: 126,440,197 V294A probably benign Het
Rsph1 A G 17: 31,277,252 S2P unknown Het
Sacs A G 14: 61,210,518 K3338E probably damaging Het
Slc35f4 T G 14: 49,318,960 N112T probably benign Het
Slc43a3 T C 2: 84,938,285 F83L probably damaging Het
Slc6a15 T C 10: 103,393,914 V154A probably damaging Het
Synj2 T A 17: 5,986,014 M1K probably null Het
Tcp1 G A 17: 12,923,253 R378Q probably damaging Het
Tead2 A G 7: 45,217,234 T6A probably benign Het
Tpte G T 8: 22,355,475 V514L probably damaging Het
Trpm6 A G 19: 18,830,297 N1069D probably damaging Het
Uhrf1bp1l T A 10: 89,805,684 S906T probably benign Het
Vmn2r105 C A 17: 20,208,343 G824C probably damaging Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zfp934 A T 13: 62,492,932 N2K probably damaging Het
Other mutations in Olfr464
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01353:Olfr464 APN 11 87914172 missense probably benign 0.09
IGL02011:Olfr464 APN 11 87914882 missense probably benign 0.01
IGL02218:Olfr464 APN 11 87914063 missense probably damaging 1.00
IGL02977:Olfr464 APN 11 87914130 missense possibly damaging 0.48
IGL03083:Olfr464 APN 11 87914088 missense probably benign 0.00
IGL03154:Olfr464 APN 11 87914246 missense possibly damaging 0.90
R0241:Olfr464 UTSW 11 87914034 missense probably damaging 1.00
R0241:Olfr464 UTSW 11 87914034 missense probably damaging 1.00
R4679:Olfr464 UTSW 11 87914310 missense probably benign 0.13
R4734:Olfr464 UTSW 11 87914190 missense probably damaging 1.00
R4939:Olfr464 UTSW 11 87914124 missense probably damaging 1.00
R5917:Olfr464 UTSW 11 87914389 missense probably damaging 1.00
R8289:Olfr464 UTSW 11 87914763 missense probably benign 0.07
R8328:Olfr464 UTSW 11 87914159 missense possibly damaging 0.50
R8363:Olfr464 UTSW 11 87914243 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTCCACCAGCATCTTGGG -3'
(R):5'- TGACCAATTCAACACTGATCCTG -3'

Sequencing Primer
(F):5'- CAGCATCTTGGGGGAGGTGAC -3'
(R):5'- ATTCAACACTGATCCTGCAAAG -3'
Posted On2018-08-01