Incidental Mutation 'R6729:Zfp934'
ID529985
Institutional Source Beutler Lab
Gene Symbol Zfp934
Ensembl Gene ENSMUSG00000074865
Gene Namezinc finger protein 934
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R6729 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location62479827-62571199 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 62492932 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 2 (N2K)
Ref Sequence ENSEMBL: ENSMUSP00000152461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076195] [ENSMUST00000221250] [ENSMUST00000222429]
Predicted Effect probably benign
Transcript: ENSMUST00000076195
SMART Domains Protein: ENSMUSP00000075552
Gene: ENSMUSG00000055228

DomainStartEndE-ValueType
KRAB 4 66 8.26e-16 SMART
ZnF_C2H2 133 155 2.09e-3 SMART
ZnF_C2H2 161 183 1.4e-4 SMART
ZnF_C2H2 189 211 2.57e-3 SMART
ZnF_C2H2 217 239 5.5e-3 SMART
ZnF_C2H2 245 267 7.26e-3 SMART
ZnF_C2H2 273 295 1.4e-4 SMART
ZnF_C2H2 301 323 8.6e-5 SMART
ZnF_C2H2 329 351 1.2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221250
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221494
Predicted Effect probably damaging
Transcript: ENSMUST00000222429
AA Change: N2K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,188,601 probably null Het
Acad12 A T 5: 121,607,935 H230Q probably damaging Het
AI182371 G T 2: 35,084,705 probably benign Het
Ank3 T C 10: 69,808,925 V73A probably damaging Het
Apbb1 A T 7: 105,565,381 M28K probably damaging Het
Atp6v1f A G 6: 29,467,965 D50G probably benign Het
Cdkal1 G A 13: 29,474,695 T356M probably damaging Het
Clca1 A G 3: 145,005,966 I756T probably damaging Het
Cyp17a1 A G 19: 46,670,581 V207A probably benign Het
Dnah7c A G 1: 46,672,521 E2636G possibly damaging Het
Gm13090 A T 4: 151,089,628 probably benign Het
Nceh1 T A 3: 27,241,271 L227* probably null Het
Nedd9 A G 13: 41,315,802 M625T probably damaging Het
Olfr1426 T A 19: 12,088,496 M99L probably benign Het
Olfr148 A T 9: 39,613,773 M69L probably benign Het
Olfr464 G A 11: 87,914,850 Q19* probably null Het
Olfr920 A G 9: 38,755,828 I47V probably benign Het
Pcsk4 T C 10: 80,325,101 N297S probably damaging Het
Psg21 T A 7: 18,652,591 I157F probably damaging Het
Rabep2 T C 7: 126,440,197 V294A probably benign Het
Rsph1 A G 17: 31,277,252 S2P unknown Het
Sacs A G 14: 61,210,518 K3338E probably damaging Het
Slc35f4 T G 14: 49,318,960 N112T probably benign Het
Slc43a3 T C 2: 84,938,285 F83L probably damaging Het
Slc6a15 T C 10: 103,393,914 V154A probably damaging Het
Synj2 T A 17: 5,986,014 M1K probably null Het
Tcp1 G A 17: 12,923,253 R378Q probably damaging Het
Tead2 A G 7: 45,217,234 T6A probably benign Het
Tpte G T 8: 22,355,475 V514L probably damaging Het
Trpm6 A G 19: 18,830,297 N1069D probably damaging Het
Uhrf1bp1l T A 10: 89,805,684 S906T probably benign Het
Vmn2r105 C A 17: 20,208,343 G824C probably damaging Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Other mutations in Zfp934
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1915:Zfp934 UTSW 13 62517955 missense probably damaging 1.00
R1957:Zfp934 UTSW 13 62518294 missense possibly damaging 0.83
R2113:Zfp934 UTSW 13 62518693 missense probably damaging 0.98
R2145:Zfp934 UTSW 13 62517834 missense probably damaging 1.00
R3732:Zfp934 UTSW 13 62517785 missense probably damaging 1.00
R3797:Zfp934 UTSW 13 62517888 missense probably benign
R4326:Zfp934 UTSW 13 62517559 missense probably benign 0.01
R4327:Zfp934 UTSW 13 62517559 missense probably benign 0.01
R4909:Zfp934 UTSW 13 62517954 missense probably damaging 1.00
R5236:Zfp934 UTSW 13 62517713 missense probably damaging 1.00
R5237:Zfp934 UTSW 13 62517838 missense probably damaging 1.00
R6305:Zfp934 UTSW 13 62518556 missense probably damaging 0.99
R7072:Zfp934 UTSW 13 62520525 missense probably damaging 0.99
R7186:Zfp934 UTSW 13 62492390 missense probably benign 0.12
R7235:Zfp934 UTSW 13 62518150 missense
R7453:Zfp934 UTSW 13 62518703 missense probably benign 0.40
R7552:Zfp934 UTSW 13 62492891 missense probably damaging 1.00
R7589:Zfp934 UTSW 13 62518316 missense
R7624:Zfp934 UTSW 13 62518524 missense probably benign 0.27
R7651:Zfp934 UTSW 13 62518513 missense probably benign
R7780:Zfp934 UTSW 13 62518544 missense possibly damaging 0.92
R7857:Zfp934 UTSW 13 62517547 missense
R7891:Zfp934 UTSW 13 62520189 missense probably benign 0.35
R7974:Zfp934 UTSW 13 62520189 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- GGCTATACAGAGAAACCCTGTC -3'
(R):5'- CCCCTGACTGCAGTTATAACT -3'

Sequencing Primer
(F):5'- GAGAAACCCTGTCTCGAAAAAC -3'
(R):5'- GGCTACATCCTATTCAAAGGGCTG -3'
Posted On2018-08-01