Incidental Mutation 'R6729:Sacs'
ID 529987
Institutional Source Beutler Lab
Gene Symbol Sacs
Ensembl Gene ENSMUSG00000048279
Gene Name sacsin
Synonyms E130115J16Rik
MMRRC Submission 044847-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6729 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 61375906-61478144 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 61447967 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 3338 (K3338E)
Ref Sequence ENSEMBL: ENSMUSP00000113377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089394] [ENSMUST00000119943]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000089394
SMART Domains Protein: ENSMUSP00000086816
Gene: ENSMUSG00000048279

DomainStartEndE-ValueType
SCOP:d1lm8b_ 8 66 3e-3 SMART
Blast:UBQ 9 81 3e-31 BLAST
Blast:HATPase_c 116 211 2e-10 BLAST
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119943
AA Change: K3338E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113377
Gene: ENSMUSG00000048279
AA Change: K3338E

DomainStartEndE-ValueType
internal_repeat_1 61 514 1.35e-52 PROSPERO
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
low complexity region 1019 1033 N/A INTRINSIC
low complexity region 1131 1145 N/A INTRINSIC
low complexity region 1526 1537 N/A INTRINSIC
low complexity region 2454 2463 N/A INTRINSIC
internal_repeat_1 2475 2934 1.35e-52 PROSPERO
low complexity region 3751 3760 N/A INTRINSIC
low complexity region 3997 4012 N/A INTRINSIC
low complexity region 4285 4300 N/A INTRINSIC
Blast:DnaJ 4304 4363 1e-31 BLAST
PDB:1IUR|A 4309 4376 5e-39 PDB
SCOP:d1gh6a_ 4317 4407 2e-3 SMART
HEPN 4454 4570 9.49e-24 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 100% (34/34)
MGI Phenotype PHENOTYPE: Mice homozygous for a knockout allele exhibit Purkinje cell degeneration with thickened tortuous dendrites and altered mitochondrial dysfunction. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad12 A T 5: 121,745,998 (GRCm39) H230Q probably damaging Het
AI182371 G T 2: 34,974,717 (GRCm39) probably benign Het
Ank3 T C 10: 69,644,755 (GRCm39) V73A probably damaging Het
Apbb1 A T 7: 105,214,588 (GRCm39) M28K probably damaging Het
Atp6v1f A G 6: 29,467,964 (GRCm39) D50G probably benign Het
Bltp3b T A 10: 89,641,546 (GRCm39) S906T probably benign Het
Cdkal1 G A 13: 29,658,678 (GRCm39) T356M probably damaging Het
Clca3a1 A G 3: 144,711,727 (GRCm39) I756T probably damaging Het
Cplane1 T C 15: 8,218,085 (GRCm39) probably null Het
Cyp17a1 A G 19: 46,659,020 (GRCm39) V207A probably benign Het
Dnah7c A G 1: 46,711,681 (GRCm39) E2636G possibly damaging Het
Gm13090 A T 4: 151,174,085 (GRCm39) probably benign Het
Nceh1 T A 3: 27,295,420 (GRCm39) L227* probably null Het
Nedd9 A G 13: 41,469,278 (GRCm39) M625T probably damaging Het
Or10n1 A T 9: 39,525,069 (GRCm39) M69L probably benign Het
Or4d1 G A 11: 87,805,676 (GRCm39) Q19* probably null Het
Or4d10c T A 19: 12,065,860 (GRCm39) M99L probably benign Het
Or8b53 A G 9: 38,667,124 (GRCm39) I47V probably benign Het
Pcsk4 T C 10: 80,160,935 (GRCm39) N297S probably damaging Het
Psg21 T A 7: 18,386,516 (GRCm39) I157F probably damaging Het
Rabep2 T C 7: 126,039,369 (GRCm39) V294A probably benign Het
Rsph1 A G 17: 31,496,226 (GRCm39) S2P unknown Het
Slc35f4 T G 14: 49,556,417 (GRCm39) N112T probably benign Het
Slc43a3 T C 2: 84,768,629 (GRCm39) F83L probably damaging Het
Slc6a15 T C 10: 103,229,775 (GRCm39) V154A probably damaging Het
Synj2 T A 17: 6,036,289 (GRCm39) M1K probably null Het
Tcp1 G A 17: 13,142,140 (GRCm39) R378Q probably damaging Het
Tead2 A G 7: 44,866,658 (GRCm39) T6A probably benign Het
Tpte G T 8: 22,845,491 (GRCm39) V514L probably damaging Het
Trpm6 A G 19: 18,807,661 (GRCm39) N1069D probably damaging Het
Vmn2r105 C A 17: 20,428,605 (GRCm39) G824C probably damaging Het
Yod1 G A 1: 130,645,275 (GRCm39) G19S probably damaging Het
Zfp934 A T 13: 62,640,746 (GRCm39) N2K probably damaging Het
Other mutations in Sacs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01540:Sacs APN 14 61,429,084 (GRCm39) missense possibly damaging 0.64
IGL01839:Sacs APN 14 61,421,394 (GRCm39) intron probably benign
IGL02024:Sacs APN 14 61,427,127 (GRCm39) missense probably damaging 0.96
IGL02247:Sacs APN 14 61,429,984 (GRCm39) missense probably damaging 1.00
BB009:Sacs UTSW 14 61,442,327 (GRCm39) missense probably damaging 0.99
BB019:Sacs UTSW 14 61,442,327 (GRCm39) missense probably damaging 0.99
F6893:Sacs UTSW 14 61,450,425 (GRCm39) missense probably benign
IGL03052:Sacs UTSW 14 61,445,307 (GRCm39) missense probably damaging 0.99
R0090:Sacs UTSW 14 61,442,889 (GRCm39) missense probably damaging 1.00
R0102:Sacs UTSW 14 61,442,017 (GRCm39) missense probably damaging 1.00
R0102:Sacs UTSW 14 61,442,017 (GRCm39) missense probably damaging 1.00
R0390:Sacs UTSW 14 61,443,089 (GRCm39) missense possibly damaging 0.92
R0479:Sacs UTSW 14 61,428,928 (GRCm39) missense probably damaging 0.99
R0556:Sacs UTSW 14 61,421,407 (GRCm39) missense probably damaging 0.99
R0673:Sacs UTSW 14 61,447,664 (GRCm39) missense possibly damaging 0.89
R0748:Sacs UTSW 14 61,446,714 (GRCm39) missense probably damaging 0.99
R0931:Sacs UTSW 14 61,440,944 (GRCm39) missense probably benign
R0972:Sacs UTSW 14 61,449,412 (GRCm39) nonsense probably null
R1281:Sacs UTSW 14 61,429,250 (GRCm39) missense probably benign 0.02
R1340:Sacs UTSW 14 61,441,958 (GRCm39) missense probably damaging 0.98
R1351:Sacs UTSW 14 61,440,210 (GRCm39) missense probably benign 0.00
R1499:Sacs UTSW 14 61,451,153 (GRCm39) missense possibly damaging 0.70
R1538:Sacs UTSW 14 61,447,508 (GRCm39) missense probably damaging 0.98
R1581:Sacs UTSW 14 61,451,128 (GRCm39) missense probably damaging 0.96
R1599:Sacs UTSW 14 61,441,087 (GRCm39) missense probably benign
R1631:Sacs UTSW 14 61,448,181 (GRCm39) nonsense probably null
R1635:Sacs UTSW 14 61,441,277 (GRCm39) missense probably damaging 0.98
R1655:Sacs UTSW 14 61,429,231 (GRCm39) missense probably benign
R1660:Sacs UTSW 14 61,446,458 (GRCm39) missense probably damaging 0.99
R1707:Sacs UTSW 14 61,447,211 (GRCm39) missense probably benign 0.01
R1733:Sacs UTSW 14 61,442,903 (GRCm39) missense probably damaging 1.00
R1772:Sacs UTSW 14 61,448,346 (GRCm39) missense probably damaging 1.00
R1976:Sacs UTSW 14 61,440,344 (GRCm39) missense probably benign
R2055:Sacs UTSW 14 61,451,498 (GRCm39) missense probably damaging 0.97
R2083:Sacs UTSW 14 61,443,955 (GRCm39) missense possibly damaging 0.69
R2091:Sacs UTSW 14 61,429,368 (GRCm39) missense possibly damaging 0.95
R2105:Sacs UTSW 14 61,410,890 (GRCm39) missense possibly damaging 0.90
R2109:Sacs UTSW 14 61,410,902 (GRCm39) splice site probably null
R2117:Sacs UTSW 14 61,451,220 (GRCm39) missense probably benign 0.01
R2122:Sacs UTSW 14 61,449,765 (GRCm39) missense probably damaging 1.00
R2148:Sacs UTSW 14 61,410,827 (GRCm39) missense probably damaging 0.97
R2151:Sacs UTSW 14 61,447,089 (GRCm39) missense probably damaging 1.00
R2231:Sacs UTSW 14 61,443,378 (GRCm39) splice site probably null
R2248:Sacs UTSW 14 61,450,251 (GRCm39) missense probably damaging 1.00
R2271:Sacs UTSW 14 61,442,109 (GRCm39) missense probably benign 0.06
R2314:Sacs UTSW 14 61,445,208 (GRCm39) missense probably benign 0.17
R2436:Sacs UTSW 14 61,440,354 (GRCm39) missense possibly damaging 0.94
R2445:Sacs UTSW 14 61,442,655 (GRCm39) missense probably damaging 1.00
R2512:Sacs UTSW 14 61,440,529 (GRCm39) missense probably benign 0.00
R3434:Sacs UTSW 14 61,449,752 (GRCm39) missense probably damaging 1.00
R3785:Sacs UTSW 14 61,421,410 (GRCm39) missense probably damaging 1.00
R3786:Sacs UTSW 14 61,421,410 (GRCm39) missense probably damaging 1.00
R3796:Sacs UTSW 14 61,443,570 (GRCm39) missense possibly damaging 0.87
R3798:Sacs UTSW 14 61,443,570 (GRCm39) missense possibly damaging 0.87
R3872:Sacs UTSW 14 61,385,517 (GRCm39) missense probably benign 0.30
R3873:Sacs UTSW 14 61,429,735 (GRCm39) missense possibly damaging 0.64
R3892:Sacs UTSW 14 61,441,836 (GRCm39) missense probably damaging 0.98
R4184:Sacs UTSW 14 61,451,393 (GRCm39) missense probably damaging 0.97
R4204:Sacs UTSW 14 61,410,892 (GRCm39) missense possibly damaging 0.93
R4249:Sacs UTSW 14 61,440,906 (GRCm39) missense probably benign 0.02
R4256:Sacs UTSW 14 61,443,786 (GRCm39) missense probably damaging 1.00
R4370:Sacs UTSW 14 61,449,758 (GRCm39) missense probably damaging 1.00
R4445:Sacs UTSW 14 61,442,135 (GRCm39) missense probably benign 0.30
R4503:Sacs UTSW 14 61,445,052 (GRCm39) missense probably damaging 1.00
R4548:Sacs UTSW 14 61,429,387 (GRCm39) missense probably damaging 1.00
R4582:Sacs UTSW 14 61,429,147 (GRCm39) missense probably damaging 1.00
R4613:Sacs UTSW 14 61,449,246 (GRCm39) splice site probably null
R4639:Sacs UTSW 14 61,444,717 (GRCm39) missense probably benign 0.12
R4697:Sacs UTSW 14 61,450,196 (GRCm39) missense probably benign 0.19
R4706:Sacs UTSW 14 61,441,722 (GRCm39) missense probably damaging 1.00
R4717:Sacs UTSW 14 61,450,304 (GRCm39) missense probably damaging 1.00
R4777:Sacs UTSW 14 61,449,258 (GRCm39) missense probably damaging 1.00
R4888:Sacs UTSW 14 61,449,647 (GRCm39) missense probably damaging 1.00
R4913:Sacs UTSW 14 61,451,246 (GRCm39) missense probably benign 0.17
R4973:Sacs UTSW 14 61,450,571 (GRCm39) missense probably damaging 1.00
R4986:Sacs UTSW 14 61,450,492 (GRCm39) nonsense probably null
R5090:Sacs UTSW 14 61,442,702 (GRCm39) missense probably damaging 1.00
R5243:Sacs UTSW 14 61,443,406 (GRCm39) nonsense probably null
R5292:Sacs UTSW 14 61,449,432 (GRCm39) missense probably damaging 1.00
R5308:Sacs UTSW 14 61,429,849 (GRCm39) missense probably benign 0.21
R5337:Sacs UTSW 14 61,430,963 (GRCm39) intron probably benign
R5502:Sacs UTSW 14 61,443,549 (GRCm39) missense probably damaging 1.00
R5586:Sacs UTSW 14 61,443,890 (GRCm39) nonsense probably null
R5692:Sacs UTSW 14 61,445,288 (GRCm39) missense probably benign 0.00
R5725:Sacs UTSW 14 61,448,559 (GRCm39) missense probably damaging 1.00
R5854:Sacs UTSW 14 61,448,996 (GRCm39) missense probably damaging 1.00
R5959:Sacs UTSW 14 61,449,849 (GRCm39) missense probably damaging 0.99
R5960:Sacs UTSW 14 61,446,144 (GRCm39) missense probably benign 0.30
R5968:Sacs UTSW 14 61,427,078 (GRCm39) missense probably damaging 0.99
R5983:Sacs UTSW 14 61,442,648 (GRCm39) missense probably damaging 1.00
R5992:Sacs UTSW 14 61,442,992 (GRCm39) missense probably damaging 1.00
R6076:Sacs UTSW 14 61,441,985 (GRCm39) nonsense probably null
R6175:Sacs UTSW 14 61,450,275 (GRCm39) missense possibly damaging 0.82
R6347:Sacs UTSW 14 61,448,609 (GRCm39) missense probably damaging 1.00
R6357:Sacs UTSW 14 61,446,273 (GRCm39) missense possibly damaging 0.47
R6415:Sacs UTSW 14 61,442,808 (GRCm39) missense probably damaging 1.00
R6469:Sacs UTSW 14 61,428,697 (GRCm39) missense probably damaging 1.00
R6503:Sacs UTSW 14 61,448,810 (GRCm39) missense probably benign 0.00
R6523:Sacs UTSW 14 61,440,410 (GRCm39) missense probably damaging 0.99
R6615:Sacs UTSW 14 61,446,383 (GRCm39) missense probably benign 0.15
R6731:Sacs UTSW 14 61,418,149 (GRCm39) splice site probably null
R6797:Sacs UTSW 14 61,450,522 (GRCm39) missense probably damaging 1.00
R6852:Sacs UTSW 14 61,416,737 (GRCm39) missense possibly damaging 0.87
R6922:Sacs UTSW 14 61,448,874 (GRCm39) missense probably damaging 1.00
R7023:Sacs UTSW 14 61,446,264 (GRCm39) missense probably benign 0.04
R7047:Sacs UTSW 14 61,450,451 (GRCm39) missense probably damaging 1.00
R7051:Sacs UTSW 14 61,446,377 (GRCm39) missense probably benign 0.25
R7069:Sacs UTSW 14 61,449,945 (GRCm39) missense probably damaging 1.00
R7082:Sacs UTSW 14 61,447,966 (GRCm39) missense possibly damaging 0.94
R7108:Sacs UTSW 14 61,448,458 (GRCm39) nonsense probably null
R7122:Sacs UTSW 14 61,447,845 (GRCm39) missense probably damaging 1.00
R7194:Sacs UTSW 14 61,447,538 (GRCm39) missense possibly damaging 0.95
R7214:Sacs UTSW 14 61,429,241 (GRCm39) missense probably benign
R7221:Sacs UTSW 14 61,446,255 (GRCm39) missense probably damaging 0.99
R7274:Sacs UTSW 14 61,451,530 (GRCm39) missense possibly damaging 0.88
R7344:Sacs UTSW 14 61,444,893 (GRCm39) missense possibly damaging 0.81
R7440:Sacs UTSW 14 61,429,054 (GRCm39) missense probably benign 0.10
R7474:Sacs UTSW 14 61,448,627 (GRCm39) missense probably benign 0.04
R7512:Sacs UTSW 14 61,441,879 (GRCm39) missense probably benign 0.04
R7641:Sacs UTSW 14 61,440,320 (GRCm39) missense probably damaging 0.97
R7649:Sacs UTSW 14 61,440,677 (GRCm39) missense possibly damaging 0.53
R7703:Sacs UTSW 14 61,443,539 (GRCm39) missense possibly damaging 0.81
R7792:Sacs UTSW 14 61,447,222 (GRCm39) missense probably benign 0.00
R7805:Sacs UTSW 14 61,441,040 (GRCm39) missense not run
R7822:Sacs UTSW 14 61,429,652 (GRCm39) missense probably benign 0.03
R7882:Sacs UTSW 14 61,444,520 (GRCm39) missense probably benign 0.02
R7932:Sacs UTSW 14 61,442,327 (GRCm39) missense probably damaging 0.99
R8031:Sacs UTSW 14 61,441,640 (GRCm39) missense probably damaging 0.96
R8064:Sacs UTSW 14 61,429,624 (GRCm39) missense possibly damaging 0.92
R8083:Sacs UTSW 14 61,448,166 (GRCm39) missense possibly damaging 0.77
R8204:Sacs UTSW 14 61,450,397 (GRCm39) missense probably damaging 0.96
R8293:Sacs UTSW 14 61,428,548 (GRCm39) missense probably damaging 0.99
R8316:Sacs UTSW 14 61,427,068 (GRCm39) missense possibly damaging 0.84
R8393:Sacs UTSW 14 61,410,655 (GRCm39) start codon destroyed probably null 0.06
R8434:Sacs UTSW 14 61,450,636 (GRCm39) nonsense probably null
R8482:Sacs UTSW 14 61,440,404 (GRCm39) missense probably benign
R8497:Sacs UTSW 14 61,429,702 (GRCm39) missense probably benign 0.00
R8557:Sacs UTSW 14 61,444,725 (GRCm39) missense probably damaging 1.00
R8698:Sacs UTSW 14 61,450,802 (GRCm39) missense probably benign
R8840:Sacs UTSW 14 61,429,177 (GRCm39) missense probably benign 0.25
R8924:Sacs UTSW 14 61,448,702 (GRCm39) missense probably damaging 1.00
R8924:Sacs UTSW 14 61,429,895 (GRCm39) missense probably benign 0.22
R8941:Sacs UTSW 14 61,430,022 (GRCm39) missense probably benign 0.00
R9007:Sacs UTSW 14 61,445,185 (GRCm39) missense probably benign 0.04
R9008:Sacs UTSW 14 61,441,992 (GRCm39) missense probably benign 0.19
R9070:Sacs UTSW 14 61,447,751 (GRCm39) missense probably benign
R9147:Sacs UTSW 14 61,450,137 (GRCm39) missense possibly damaging 0.86
R9185:Sacs UTSW 14 61,444,115 (GRCm39) missense probably damaging 0.98
R9290:Sacs UTSW 14 61,421,499 (GRCm39) missense probably benign 0.17
R9294:Sacs UTSW 14 61,477,768 (GRCm39) missense possibly damaging 0.84
R9339:Sacs UTSW 14 61,443,309 (GRCm39) missense probably benign 0.00
R9341:Sacs UTSW 14 61,446,219 (GRCm39) missense probably benign 0.08
R9343:Sacs UTSW 14 61,446,219 (GRCm39) missense probably benign 0.08
R9370:Sacs UTSW 14 61,441,080 (GRCm39) missense probably damaging 1.00
R9433:Sacs UTSW 14 61,443,997 (GRCm39) missense probably damaging 1.00
R9460:Sacs UTSW 14 61,441,611 (GRCm39) missense probably benign 0.34
R9548:Sacs UTSW 14 61,440,692 (GRCm39) missense probably benign 0.02
R9564:Sacs UTSW 14 61,449,046 (GRCm39) missense probably damaging 1.00
R9644:Sacs UTSW 14 61,443,428 (GRCm39) missense probably benign 0.00
R9683:Sacs UTSW 14 61,450,881 (GRCm39) missense possibly damaging 0.95
R9706:Sacs UTSW 14 61,445,822 (GRCm39) nonsense probably null
X0067:Sacs UTSW 14 61,445,468 (GRCm39) missense probably damaging 1.00
Z1176:Sacs UTSW 14 61,450,649 (GRCm39) missense probably damaging 1.00
Z1176:Sacs UTSW 14 61,448,279 (GRCm39) nonsense probably null
Z1177:Sacs UTSW 14 61,445,430 (GRCm39) missense possibly damaging 0.93
Z1177:Sacs UTSW 14 61,429,000 (GRCm39) missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- GGCATTGCTTCCAGGAACAAAG -3'
(R):5'- ATTTGTAGCATGGGAGGGAC -3'

Sequencing Primer
(F):5'- GCTTCCAGGAACAAAGTTCACTGTG -3'
(R):5'- GTCATCTTGGGACATCAAGTGACTC -3'
Posted On 2018-08-01