Incidental Mutation 'R6729:Vmn2r105'
ID 529991
Institutional Source Beutler Lab
Gene Symbol Vmn2r105
Ensembl Gene ENSMUSG00000091670
Gene Name vomeronasal 2, receptor 105
Synonyms EG627743
MMRRC Submission 044847-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6729 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 20428492-20455134 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 20428605 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Cysteine at position 824 (G824C)
Ref Sequence ENSEMBL: ENSMUSP00000129762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167382]
AlphaFold E9Q3A5
Predicted Effect probably damaging
Transcript: ENSMUST00000167382
AA Change: G824C

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129762
Gene: ENSMUSG00000091670
AA Change: G824C

DomainStartEndE-ValueType
Pfam:ANF_receptor 85 469 6.5e-42 PFAM
Pfam:NCD3G 512 565 3.2e-21 PFAM
Pfam:7tm_3 598 833 2.5e-51 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad12 A T 5: 121,745,998 (GRCm39) H230Q probably damaging Het
AI182371 G T 2: 34,974,717 (GRCm39) probably benign Het
Ank3 T C 10: 69,644,755 (GRCm39) V73A probably damaging Het
Apbb1 A T 7: 105,214,588 (GRCm39) M28K probably damaging Het
Atp6v1f A G 6: 29,467,964 (GRCm39) D50G probably benign Het
Bltp3b T A 10: 89,641,546 (GRCm39) S906T probably benign Het
Cdkal1 G A 13: 29,658,678 (GRCm39) T356M probably damaging Het
Clca3a1 A G 3: 144,711,727 (GRCm39) I756T probably damaging Het
Cplane1 T C 15: 8,218,085 (GRCm39) probably null Het
Cyp17a1 A G 19: 46,659,020 (GRCm39) V207A probably benign Het
Dnah7c A G 1: 46,711,681 (GRCm39) E2636G possibly damaging Het
Gm13090 A T 4: 151,174,085 (GRCm39) probably benign Het
Nceh1 T A 3: 27,295,420 (GRCm39) L227* probably null Het
Nedd9 A G 13: 41,469,278 (GRCm39) M625T probably damaging Het
Or10n1 A T 9: 39,525,069 (GRCm39) M69L probably benign Het
Or4d1 G A 11: 87,805,676 (GRCm39) Q19* probably null Het
Or4d10c T A 19: 12,065,860 (GRCm39) M99L probably benign Het
Or8b53 A G 9: 38,667,124 (GRCm39) I47V probably benign Het
Pcsk4 T C 10: 80,160,935 (GRCm39) N297S probably damaging Het
Psg21 T A 7: 18,386,516 (GRCm39) I157F probably damaging Het
Rabep2 T C 7: 126,039,369 (GRCm39) V294A probably benign Het
Rsph1 A G 17: 31,496,226 (GRCm39) S2P unknown Het
Sacs A G 14: 61,447,967 (GRCm39) K3338E probably damaging Het
Slc35f4 T G 14: 49,556,417 (GRCm39) N112T probably benign Het
Slc43a3 T C 2: 84,768,629 (GRCm39) F83L probably damaging Het
Slc6a15 T C 10: 103,229,775 (GRCm39) V154A probably damaging Het
Synj2 T A 17: 6,036,289 (GRCm39) M1K probably null Het
Tcp1 G A 17: 13,142,140 (GRCm39) R378Q probably damaging Het
Tead2 A G 7: 44,866,658 (GRCm39) T6A probably benign Het
Tpte G T 8: 22,845,491 (GRCm39) V514L probably damaging Het
Trpm6 A G 19: 18,807,661 (GRCm39) N1069D probably damaging Het
Yod1 G A 1: 130,645,275 (GRCm39) G19S probably damaging Het
Zfp934 A T 13: 62,640,746 (GRCm39) N2K probably damaging Het
Other mutations in Vmn2r105
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:Vmn2r105 APN 17 20,448,817 (GRCm39) missense probably benign 0.01
IGL01909:Vmn2r105 APN 17 20,444,918 (GRCm39) missense probably damaging 1.00
IGL01925:Vmn2r105 APN 17 20,428,973 (GRCm39) missense possibly damaging 0.94
IGL02021:Vmn2r105 APN 17 20,448,157 (GRCm39) missense possibly damaging 0.49
IGL02828:Vmn2r105 APN 17 20,429,345 (GRCm39) missense possibly damaging 0.80
IGL02838:Vmn2r105 APN 17 20,447,847 (GRCm39) missense probably damaging 1.00
IGL03343:Vmn2r105 APN 17 20,446,631 (GRCm39) nonsense probably null
R0096:Vmn2r105 UTSW 17 20,447,741 (GRCm39) missense possibly damaging 0.49
R0096:Vmn2r105 UTSW 17 20,447,741 (GRCm39) missense possibly damaging 0.49
R0212:Vmn2r105 UTSW 17 20,428,827 (GRCm39) missense possibly damaging 0.90
R0268:Vmn2r105 UTSW 17 20,428,938 (GRCm39) missense probably benign 0.18
R0271:Vmn2r105 UTSW 17 20,454,965 (GRCm39) missense probably damaging 0.96
R0613:Vmn2r105 UTSW 17 20,428,578 (GRCm39) missense probably damaging 1.00
R0765:Vmn2r105 UTSW 17 20,448,119 (GRCm39) missense probably damaging 0.98
R0765:Vmn2r105 UTSW 17 20,447,973 (GRCm39) missense probably benign 0.20
R1162:Vmn2r105 UTSW 17 20,447,973 (GRCm39) missense probably benign 0.20
R1263:Vmn2r105 UTSW 17 20,428,584 (GRCm39) missense probably damaging 1.00
R1363:Vmn2r105 UTSW 17 20,428,932 (GRCm39) missense probably benign 0.00
R1464:Vmn2r105 UTSW 17 20,449,004 (GRCm39) splice site probably benign
R2029:Vmn2r105 UTSW 17 20,444,840 (GRCm39) missense probably damaging 0.99
R2420:Vmn2r105 UTSW 17 20,448,097 (GRCm39) missense probably benign 0.15
R2421:Vmn2r105 UTSW 17 20,448,097 (GRCm39) missense probably benign 0.15
R2422:Vmn2r105 UTSW 17 20,448,097 (GRCm39) missense probably benign 0.15
R2570:Vmn2r105 UTSW 17 20,447,585 (GRCm39) missense probably damaging 1.00
R3847:Vmn2r105 UTSW 17 20,428,952 (GRCm39) missense possibly damaging 0.85
R3848:Vmn2r105 UTSW 17 20,428,952 (GRCm39) missense possibly damaging 0.85
R4030:Vmn2r105 UTSW 17 20,429,016 (GRCm39) missense probably damaging 0.99
R4275:Vmn2r105 UTSW 17 20,448,902 (GRCm39) missense probably damaging 1.00
R4551:Vmn2r105 UTSW 17 20,446,613 (GRCm39) missense probably benign
R4801:Vmn2r105 UTSW 17 20,447,556 (GRCm39) missense probably benign 0.00
R4802:Vmn2r105 UTSW 17 20,447,556 (GRCm39) missense probably benign 0.00
R4816:Vmn2r105 UTSW 17 20,428,953 (GRCm39) missense probably benign 0.27
R4929:Vmn2r105 UTSW 17 20,448,280 (GRCm39) missense probably benign 0.44
R5022:Vmn2r105 UTSW 17 20,428,676 (GRCm39) missense probably damaging 0.99
R5475:Vmn2r105 UTSW 17 20,455,044 (GRCm39) missense probably benign
R5576:Vmn2r105 UTSW 17 20,444,836 (GRCm39) critical splice donor site probably null
R5795:Vmn2r105 UTSW 17 20,448,998 (GRCm39) missense probably benign 0.00
R5895:Vmn2r105 UTSW 17 20,448,929 (GRCm39) missense probably benign 0.10
R6017:Vmn2r105 UTSW 17 20,428,889 (GRCm39) missense probably damaging 0.97
R6210:Vmn2r105 UTSW 17 20,448,758 (GRCm39) missense probably damaging 1.00
R6491:Vmn2r105 UTSW 17 20,447,992 (GRCm39) nonsense probably null
R6542:Vmn2r105 UTSW 17 20,448,803 (GRCm39) missense probably benign 0.03
R7020:Vmn2r105 UTSW 17 20,429,336 (GRCm39) missense probably damaging 1.00
R7033:Vmn2r105 UTSW 17 20,428,874 (GRCm39) missense probably damaging 0.97
R7488:Vmn2r105 UTSW 17 20,429,045 (GRCm39) missense probably damaging 1.00
R7491:Vmn2r105 UTSW 17 20,448,827 (GRCm39) missense probably benign 0.02
R7555:Vmn2r105 UTSW 17 20,447,937 (GRCm39) missense probably damaging 0.98
R7863:Vmn2r105 UTSW 17 20,428,937 (GRCm39) missense probably benign 0.18
R8137:Vmn2r105 UTSW 17 20,454,966 (GRCm39) missense probably benign 0.02
R8166:Vmn2r105 UTSW 17 20,428,904 (GRCm39) missense probably benign 0.07
R8186:Vmn2r105 UTSW 17 20,444,880 (GRCm39) nonsense probably null
R8214:Vmn2r105 UTSW 17 20,448,775 (GRCm39) missense probably benign 0.02
R8497:Vmn2r105 UTSW 17 20,455,134 (GRCm39) start codon destroyed probably null 0.75
R8850:Vmn2r105 UTSW 17 20,428,872 (GRCm39) missense probably damaging 1.00
R8880:Vmn2r105 UTSW 17 20,429,229 (GRCm39) missense probably damaging 0.99
R9272:Vmn2r105 UTSW 17 20,447,685 (GRCm39) missense probably damaging 1.00
R9506:Vmn2r105 UTSW 17 20,429,404 (GRCm39) missense probably benign 0.00
R9549:Vmn2r105 UTSW 17 20,448,023 (GRCm39) missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- AAGGCTCTCACAGTAGAACATTG -3'
(R):5'- CCGTGGCCTTCTTATCTAGAAC -3'

Sequencing Primer
(F):5'- GCTCTCACAGTAGAACATTGTAATAC -3'
(R):5'- CTCTTCCTGATACATTCAATGAATCC -3'
Posted On 2018-08-01