Incidental Mutation 'R6729:Cyp17a1'
ID 529995
Institutional Source Beutler Lab
Gene Symbol Cyp17a1
Ensembl Gene ENSMUSG00000003555
Gene Name cytochrome P450, family 17, subfamily a, polypeptide 1
Synonyms steroid 17-alpha hydroxylase, p450c17, Cyp17
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.201) question?
Stock # R6729 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 46667165-46672974 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 46670581 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 207 (V207A)
Ref Sequence ENSEMBL: ENSMUSP00000026012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026012]
AlphaFold P27786
Predicted Effect probably benign
Transcript: ENSMUST00000026012
AA Change: V207A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026012
Gene: ENSMUSG00000003555
AA Change: V207A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:p450 28 492 2.6e-140 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131142
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156577
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182599
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. It has both 17alpha-hydroxylase and 17,20-lyase activities and is a key enzyme in the steroidogenic pathway that produces progestins, mineralocorticoids, glucocorticoids, androgens, and estrogens. Mutations in this gene are associated with isolated steroid-17 alpha-hydroxylase deficiency, 17-alpha-hydroxylase/17,20-lyase deficiency, pseudohermaphroditism, and adrenal hyperplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos display early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,188,601 probably null Het
Acad12 A T 5: 121,607,935 H230Q probably damaging Het
AI182371 G T 2: 35,084,705 probably benign Het
Ank3 T C 10: 69,808,925 V73A probably damaging Het
Apbb1 A T 7: 105,565,381 M28K probably damaging Het
Atp6v1f A G 6: 29,467,965 D50G probably benign Het
Cdkal1 G A 13: 29,474,695 T356M probably damaging Het
Clca1 A G 3: 145,005,966 I756T probably damaging Het
Dnah7c A G 1: 46,672,521 E2636G possibly damaging Het
Gm13090 A T 4: 151,089,628 probably benign Het
Nceh1 T A 3: 27,241,271 L227* probably null Het
Nedd9 A G 13: 41,315,802 M625T probably damaging Het
Olfr1426 T A 19: 12,088,496 M99L probably benign Het
Olfr148 A T 9: 39,613,773 M69L probably benign Het
Olfr464 G A 11: 87,914,850 Q19* probably null Het
Olfr920 A G 9: 38,755,828 I47V probably benign Het
Pcsk4 T C 10: 80,325,101 N297S probably damaging Het
Psg21 T A 7: 18,652,591 I157F probably damaging Het
Rabep2 T C 7: 126,440,197 V294A probably benign Het
Rsph1 A G 17: 31,277,252 S2P unknown Het
Sacs A G 14: 61,210,518 K3338E probably damaging Het
Slc35f4 T G 14: 49,318,960 N112T probably benign Het
Slc43a3 T C 2: 84,938,285 F83L probably damaging Het
Slc6a15 T C 10: 103,393,914 V154A probably damaging Het
Synj2 T A 17: 5,986,014 M1K probably null Het
Tcp1 G A 17: 12,923,253 R378Q probably damaging Het
Tead2 A G 7: 45,217,234 T6A probably benign Het
Tpte G T 8: 22,355,475 V514L probably damaging Het
Trpm6 A G 19: 18,830,297 N1069D probably damaging Het
Uhrf1bp1l T A 10: 89,805,684 S906T probably benign Het
Vmn2r105 C A 17: 20,208,343 G824C probably damaging Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zfp934 A T 13: 62,492,932 N2K probably damaging Het
Other mutations in Cyp17a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:Cyp17a1 APN 19 46671056 missense probably benign 0.00
IGL01839:Cyp17a1 APN 19 46670671 missense possibly damaging 0.89
IGL01901:Cyp17a1 APN 19 46671092 missense possibly damaging 0.64
IGL02033:Cyp17a1 APN 19 46672607 nonsense probably null
IGL02349:Cyp17a1 APN 19 46667497 missense probably damaging 1.00
IGL02663:Cyp17a1 APN 19 46672566 missense probably damaging 1.00
IGL02883:Cyp17a1 APN 19 46669351 missense probably benign 0.00
IGL03092:Cyp17a1 APN 19 46672611 missense possibly damaging 0.79
IGL03239:Cyp17a1 APN 19 46667357 missense probably damaging 1.00
IGL03336:Cyp17a1 APN 19 46671035 missense probably benign 0.00
R3773:Cyp17a1 UTSW 19 46669723 missense probably damaging 0.97
R4445:Cyp17a1 UTSW 19 46668023 missense probably damaging 1.00
R4446:Cyp17a1 UTSW 19 46668023 missense probably damaging 1.00
R4572:Cyp17a1 UTSW 19 46670551 missense probably damaging 1.00
R5544:Cyp17a1 UTSW 19 46672654 missense probably damaging 1.00
R5730:Cyp17a1 UTSW 19 46672656 missense possibly damaging 0.49
R6163:Cyp17a1 UTSW 19 46669322 missense possibly damaging 0.69
R6271:Cyp17a1 UTSW 19 46672720 missense probably benign 0.17
R6728:Cyp17a1 UTSW 19 46669234 missense probably benign
R7025:Cyp17a1 UTSW 19 46670980 missense probably damaging 0.98
R7395:Cyp17a1 UTSW 19 46670695 missense probably benign
R8056:Cyp17a1 UTSW 19 46670591 missense possibly damaging 0.95
R8308:Cyp17a1 UTSW 19 46668077 missense probably benign 0.09
R8735:Cyp17a1 UTSW 19 46671094 critical splice acceptor site probably null
R8737:Cyp17a1 UTSW 19 46669727 missense probably benign 0.09
R9091:Cyp17a1 UTSW 19 46667591 missense probably benign 0.00
R9270:Cyp17a1 UTSW 19 46667591 missense probably benign 0.00
R9364:Cyp17a1 UTSW 19 46668726 missense probably damaging 1.00
R9554:Cyp17a1 UTSW 19 46668726 missense probably damaging 1.00
X0020:Cyp17a1 UTSW 19 46671020 missense possibly damaging 0.88
Z1177:Cyp17a1 UTSW 19 46672659 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CTGCTGACAAATGGCAACTAG -3'
(R):5'- GCCAACTCACTGTGTGACTTG -3'

Sequencing Primer
(F):5'- CAGAGTCATTCTCAGCTGCTTAGG -3'
(R):5'- CTTGATACTTACATACGACGGGG -3'
Posted On 2018-08-01