Incidental Mutation 'R6730:Olfr1297'
ID530000
Institutional Source Beutler Lab
Gene Symbol Olfr1297
Ensembl Gene ENSMUSG00000094858
Gene Nameolfactory receptor 1297
SynonymsGA_x6K02T2Q125-72673494-72672556, MOR248-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R6730 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location111615233-111626497 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111621735 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 113 (V113A)
Ref Sequence ENSEMBL: ENSMUSP00000150543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099612] [ENSMUST00000213398]
Predicted Effect probably damaging
Transcript: ENSMUST00000099612
AA Change: V113A

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097207
Gene: ENSMUSG00000094858
AA Change: V113A

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 4.8e-48 PFAM
Pfam:7tm_1 41 287 6.7e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213398
AA Change: V113A

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930455H04Rik T A 3: 116,983,475 *59R probably null Het
Adam10 G T 9: 70,740,176 probably null Het
Adam2 A T 14: 66,037,576 N569K possibly damaging Het
Adam20 T C 8: 40,796,659 V602A probably benign Het
Adgrb3 T C 1: 25,094,294 Y1237C probably damaging Het
Ago3 T C 4: 126,371,545 T318A probably null Het
Aknad1 G A 3: 108,752,339 G223D possibly damaging Het
Camkv T C 9: 107,948,317 S478P possibly damaging Het
Ccl27a T A 4: 41,773,342 H39L probably damaging Het
Ccser2 C A 14: 36,879,086 S447I probably damaging Het
Clvs2 A G 10: 33,528,521 L233P probably damaging Het
Csn1s2b T A 5: 87,822,268 H124Q probably benign Het
Dnhd1 T C 7: 105,703,875 L2745P probably benign Het
Dync1i2 T A 2: 71,247,140 F219L probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ephb6 C T 6: 41,617,374 Q613* probably null Het
Erc2 A C 14: 27,898,567 D50A possibly damaging Het
Fam149a T A 8: 45,381,174 D196V probably damaging Het
Fam46c T A 3: 100,472,957 N161I probably benign Het
Ficd T C 5: 113,738,712 V316A probably damaging Het
Gstm6 T A 3: 107,942,725 K18* probably null Het
Ighv1-62-1 A T 12: 115,386,892 W52R probably benign Het
Klhl18 C T 9: 110,428,911 C417Y probably damaging Het
Ly9 T A 1: 171,605,169 Y92F probably benign Het
Mettl18 C T 1: 163,997,181 T357I probably damaging Het
Myoz2 C A 3: 123,016,627 G100C probably damaging Het
Olfr517 A T 7: 108,868,573 F194I probably benign Het
Olfr871 T C 9: 20,212,502 I51T probably benign Het
Pars2 C T 4: 106,653,431 L128F probably damaging Het
Pcsk6 G T 7: 65,980,248 R374L probably damaging Het
Ptpn3 T C 4: 57,270,088 T25A probably benign Het
Rab11fip1 G A 8: 27,143,229 P1150S probably damaging Het
Rabep1 A G 11: 70,940,386 Q831R possibly damaging Het
Rad17 T C 13: 100,649,745 probably benign Het
Rxfp1 T A 3: 79,650,591 R527* probably null Het
Scnn1b C T 7: 121,902,877 P253S probably damaging Het
Skiv2l G A 17: 34,845,190 R507* probably null Het
Slc2a7 T C 4: 150,158,148 F231S probably damaging Het
Svil A G 18: 5,049,311 N196S probably benign Het
Urb1 T C 16: 90,779,083 S862G possibly damaging Het
Usp30 T C 5: 114,103,709 S87P probably damaging Het
Vmn1r177 T A 7: 23,865,812 H213L probably damaging Het
Vmn2r106 T A 17: 20,278,834 I272L possibly damaging Het
Vmn2r120 T A 17: 57,525,012 D259V probably benign Het
Other mutations in Olfr1297
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Olfr1297 APN 2 111621340 missense probably damaging 1.00
IGL01305:Olfr1297 APN 2 111621201 missense probably damaging 1.00
IGL01903:Olfr1297 APN 2 111621658 missense probably benign 0.01
IGL01984:Olfr1297 APN 2 111621582 missense probably benign 0.34
IGL03065:Olfr1297 APN 2 111621190 missense probably damaging 0.98
ANU22:Olfr1297 UTSW 2 111621201 missense probably damaging 1.00
R0313:Olfr1297 UTSW 2 111621600 missense possibly damaging 0.77
R0615:Olfr1297 UTSW 2 111621919 missense possibly damaging 0.95
R1028:Olfr1297 UTSW 2 111621525 missense probably damaging 1.00
R1078:Olfr1297 UTSW 2 111621345 missense probably damaging 1.00
R1158:Olfr1297 UTSW 2 111621741 missense probably damaging 1.00
R1419:Olfr1297 UTSW 2 111621295 missense probably benign 0.05
R1980:Olfr1297 UTSW 2 111621241 missense probably benign 0.00
R1981:Olfr1297 UTSW 2 111621241 missense probably benign 0.00
R2044:Olfr1297 UTSW 2 111621814 missense probably benign 0.02
R2080:Olfr1297 UTSW 2 111621739 missense probably benign
R2170:Olfr1297 UTSW 2 111621600 missense possibly damaging 0.77
R4494:Olfr1297 UTSW 2 111621148 nonsense probably null
R4965:Olfr1297 UTSW 2 111621534 missense probably damaging 1.00
R5175:Olfr1297 UTSW 2 111621426 missense possibly damaging 0.78
R5891:Olfr1297 UTSW 2 111621433 missense probably damaging 1.00
R6192:Olfr1297 UTSW 2 111621175 missense possibly damaging 0.91
R6383:Olfr1297 UTSW 2 111621186 missense probably benign 0.10
R7189:Olfr1297 UTSW 2 111621193 missense probably benign 0.03
R7193:Olfr1297 UTSW 2 111621255 missense probably damaging 1.00
R7199:Olfr1297 UTSW 2 111621193 missense probably benign 0.01
R7735:Olfr1297 UTSW 2 111621474 missense probably damaging 1.00
R8017:Olfr1297 UTSW 2 111622067 missense probably benign 0.00
R8019:Olfr1297 UTSW 2 111622067 missense probably benign 0.00
R8285:Olfr1297 UTSW 2 111622045 missense probably benign 0.32
R8419:Olfr1297 UTSW 2 111621504 missense probably benign 0.10
X0063:Olfr1297 UTSW 2 111621381 missense probably benign 0.04
Z1176:Olfr1297 UTSW 2 111621261 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTTGGGACCACAGAAAGG -3'
(R):5'- GCTCATCATGTCTGGAAATATTGTC -3'

Sequencing Primer
(F):5'- ACCACAGAAAGGAAGCTGC -3'
(R):5'- TCTTAATAACAACTGACCCCCATCTG -3'
Posted On2018-08-01