Incidental Mutation 'R6730:Gstm6'
List |< first << previous [record 21 of 45] next >> last >|
ID530003
Institutional Source Beutler Lab
Gene Symbol Gstm6
Ensembl Gene ENSMUSG00000068762
Gene Nameglutathione S-transferase, mu 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6730 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location107938847-107943749 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 107942725 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 18 (K18*)
Ref Sequence ENSEMBL: ENSMUSP00000139500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106681] [ENSMUST00000106683] [ENSMUST00000106684] [ENSMUST00000106685] [ENSMUST00000155926]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106680
SMART Domains Protein: ENSMUSP00000102291
Gene: ENSMUSG00000068762

DomainStartEndE-ValueType
Pfam:GST_N 3 77 6.2e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106681
AA Change: K18*
SMART Domains Protein: ENSMUSP00000102292
Gene: ENSMUSG00000068762
AA Change: K18*

DomainStartEndE-ValueType
Pfam:GST_N 1 48 9.4e-12 PFAM
Pfam:GST_C_3 7 154 7.6e-11 PFAM
Pfam:GST_C 70 154 3.6e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106683
AA Change: K18*
SMART Domains Protein: ENSMUSP00000102294
Gene: ENSMUSG00000068762
AA Change: K18*

DomainStartEndE-ValueType
Pfam:GST_C_3 4 95 6.3e-11 PFAM
Pfam:GST_C 6 97 2.1e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106684
AA Change: K52*
SMART Domains Protein: ENSMUSP00000102295
Gene: ENSMUSG00000068762
AA Change: K52*

DomainStartEndE-ValueType
Pfam:GST_N 3 82 2e-22 PFAM
Pfam:GST_C_3 41 204 4.1e-12 PFAM
Pfam:GST_C 104 205 5.9e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106685
AA Change: K52*
SMART Domains Protein: ENSMUSP00000102296
Gene: ENSMUSG00000068762
AA Change: K52*

DomainStartEndE-ValueType
Pfam:GST_N 3 82 7.9e-23 PFAM
Pfam:GST_C 104 192 8.4e-20 PFAM
Pfam:GST_C_3 113 190 6.8e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000155926
AA Change: K18*
SMART Domains Protein: ENSMUSP00000139500
Gene: ENSMUSG00000068762
AA Change: K18*

DomainStartEndE-ValueType
Pfam:GST_N 1 48 1.9e-10 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930455H04Rik T A 3: 116,983,475 *59R probably null Het
Adam10 G T 9: 70,740,176 probably null Het
Adam2 A T 14: 66,037,576 N569K possibly damaging Het
Adam20 T C 8: 40,796,659 V602A probably benign Het
Adgrb3 T C 1: 25,094,294 Y1237C probably damaging Het
Ago3 T C 4: 126,371,545 T318A probably null Het
Aknad1 G A 3: 108,752,339 G223D possibly damaging Het
Camkv T C 9: 107,948,317 S478P possibly damaging Het
Ccl27a T A 4: 41,773,342 H39L probably damaging Het
Ccser2 C A 14: 36,879,086 S447I probably damaging Het
Clvs2 A G 10: 33,528,521 L233P probably damaging Het
Csn1s2b T A 5: 87,822,268 H124Q probably benign Het
Dnhd1 T C 7: 105,703,875 L2745P probably benign Het
Dync1i2 T A 2: 71,247,140 F219L probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ephb6 C T 6: 41,617,374 Q613* probably null Het
Erc2 A C 14: 27,898,567 D50A possibly damaging Het
Fam149a T A 8: 45,381,174 D196V probably damaging Het
Fam46c T A 3: 100,472,957 N161I probably benign Het
Ficd T C 5: 113,738,712 V316A probably damaging Het
Ighv1-62-1 A T 12: 115,386,892 W52R probably benign Het
Klhl18 C T 9: 110,428,911 C417Y probably damaging Het
Ly9 T A 1: 171,605,169 Y92F probably benign Het
Mettl18 C T 1: 163,997,181 T357I probably damaging Het
Myoz2 C A 3: 123,016,627 G100C probably damaging Het
Olfr1297 A G 2: 111,621,735 V113A probably damaging Het
Olfr517 A T 7: 108,868,573 F194I probably benign Het
Olfr871 T C 9: 20,212,502 I51T probably benign Het
Pars2 C T 4: 106,653,431 L128F probably damaging Het
Pcsk6 G T 7: 65,980,248 R374L probably damaging Het
Ptpn3 T C 4: 57,270,088 T25A probably benign Het
Rab11fip1 G A 8: 27,143,229 P1150S probably damaging Het
Rabep1 A G 11: 70,940,386 Q831R possibly damaging Het
Rad17 T C 13: 100,649,745 probably benign Het
Rxfp1 T A 3: 79,650,591 R527* probably null Het
Scnn1b C T 7: 121,902,877 P253S probably damaging Het
Skiv2l G A 17: 34,845,190 R507* probably null Het
Slc2a7 T C 4: 150,158,148 F231S probably damaging Het
Svil A G 18: 5,049,311 N196S probably benign Het
Urb1 T C 16: 90,779,083 S862G possibly damaging Het
Usp30 T C 5: 114,103,709 S87P probably damaging Het
Vmn1r177 T A 7: 23,865,812 H213L probably damaging Het
Vmn2r106 T A 17: 20,278,834 I272L possibly damaging Het
Vmn2r120 T A 17: 57,525,012 D259V probably benign Het
Other mutations in Gstm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01321:Gstm6 APN 3 107941063 missense probably benign 0.15
IGL02100:Gstm6 APN 3 107942337 missense probably benign 0.20
IGL02685:Gstm6 APN 3 107941191 missense probably benign 0.25
R1221:Gstm6 UTSW 3 107941102 missense probably damaging 1.00
R2428:Gstm6 UTSW 3 107943606 missense possibly damaging 0.82
R2763:Gstm6 UTSW 3 107941042 missense possibly damaging 0.65
R6178:Gstm6 UTSW 3 107941081 missense probably benign 0.01
R6545:Gstm6 UTSW 3 107942365 missense probably damaging 1.00
R8240:Gstm6 UTSW 3 107942137 missense probably damaging 0.99
X0018:Gstm6 UTSW 3 107942747 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCACTGAATGAGAGAGCTG -3'
(R):5'- GCTTGGATTGGCTTTTACTCAC -3'

Sequencing Primer
(F):5'- TGGGACACAGCCCATCACAG -3'
(R):5'- GGATTGGCTTTTACTCACTACATAGC -3'
Posted On2018-08-01