Incidental Mutation 'R6730:Aknad1'
ID530004
Institutional Source Beutler Lab
Gene Symbol Aknad1
Ensembl Gene ENSMUSG00000049565
Gene NameAKNA domain containing 1
Synonyms4921525H12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R6730 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location108739658-108782309 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 108752339 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 223 (G223D)
Ref Sequence ENSEMBL: ENSMUSP00000121755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123556] [ENSMUST00000133931]
Predicted Effect possibly damaging
Transcript: ENSMUST00000123556
AA Change: G223D

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125068
Gene: ENSMUSG00000049565
AA Change: G223D

DomainStartEndE-ValueType
Pfam:AKNA 322 414 3.4e-44 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000133931
AA Change: G223D

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121755
Gene: ENSMUSG00000049565
AA Change: G223D

DomainStartEndE-ValueType
Pfam:AKNA 322 415 2.5e-35 PFAM
low complexity region 557 572 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150998
Meta Mutation Damage Score 0.1131 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a domain found in an AT-hook-containing transcription factor. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930455H04Rik T A 3: 116,983,475 *59R probably null Het
Adam10 G T 9: 70,740,176 probably null Het
Adam2 A T 14: 66,037,576 N569K possibly damaging Het
Adam20 T C 8: 40,796,659 V602A probably benign Het
Adgrb3 T C 1: 25,094,294 Y1237C probably damaging Het
Ago3 T C 4: 126,371,545 T318A probably null Het
Camkv T C 9: 107,948,317 S478P possibly damaging Het
Ccl27a T A 4: 41,773,342 H39L probably damaging Het
Ccser2 C A 14: 36,879,086 S447I probably damaging Het
Clvs2 A G 10: 33,528,521 L233P probably damaging Het
Csn1s2b T A 5: 87,822,268 H124Q probably benign Het
Dnhd1 T C 7: 105,703,875 L2745P probably benign Het
Dync1i2 T A 2: 71,247,140 F219L probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ephb6 C T 6: 41,617,374 Q613* probably null Het
Erc2 A C 14: 27,898,567 D50A possibly damaging Het
Fam149a T A 8: 45,381,174 D196V probably damaging Het
Fam46c T A 3: 100,472,957 N161I probably benign Het
Ficd T C 5: 113,738,712 V316A probably damaging Het
Gstm6 T A 3: 107,942,725 K18* probably null Het
Ighv1-62-1 A T 12: 115,386,892 W52R probably benign Het
Klhl18 C T 9: 110,428,911 C417Y probably damaging Het
Ly9 T A 1: 171,605,169 Y92F probably benign Het
Mettl18 C T 1: 163,997,181 T357I probably damaging Het
Myoz2 C A 3: 123,016,627 G100C probably damaging Het
Olfr1297 A G 2: 111,621,735 V113A probably damaging Het
Olfr517 A T 7: 108,868,573 F194I probably benign Het
Olfr871 T C 9: 20,212,502 I51T probably benign Het
Pars2 C T 4: 106,653,431 L128F probably damaging Het
Pcsk6 G T 7: 65,980,248 R374L probably damaging Het
Ptpn3 T C 4: 57,270,088 T25A probably benign Het
Rab11fip1 G A 8: 27,143,229 P1150S probably damaging Het
Rabep1 A G 11: 70,940,386 Q831R possibly damaging Het
Rad17 T C 13: 100,649,745 probably benign Het
Rxfp1 T A 3: 79,650,591 R527* probably null Het
Scnn1b C T 7: 121,902,877 P253S probably damaging Het
Skiv2l G A 17: 34,845,190 R507* probably null Het
Slc2a7 T C 4: 150,158,148 F231S probably damaging Het
Svil A G 18: 5,049,311 N196S probably benign Het
Urb1 T C 16: 90,779,083 S862G possibly damaging Het
Usp30 T C 5: 114,103,709 S87P probably damaging Het
Vmn1r177 T A 7: 23,865,812 H213L probably damaging Het
Vmn2r106 T A 17: 20,278,834 I272L possibly damaging Het
Vmn2r120 T A 17: 57,525,012 D259V probably benign Het
Other mutations in Aknad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00697:Aknad1 APN 3 108775008 missense probably damaging 0.96
IGL01734:Aknad1 APN 3 108751901 missense probably benign 0.05
IGL01877:Aknad1 APN 3 108775090 missense probably damaging 0.99
IGL01964:Aknad1 APN 3 108778277 missense probably benign
IGL03091:Aknad1 APN 3 108751903 missense possibly damaging 0.76
IGL03172:Aknad1 APN 3 108781203 missense possibly damaging 0.53
R0023:Aknad1 UTSW 3 108781185 missense probably benign 0.00
R0023:Aknad1 UTSW 3 108781185 missense probably benign 0.00
R0238:Aknad1 UTSW 3 108781239 missense probably benign
R0238:Aknad1 UTSW 3 108781239 missense probably benign
R0294:Aknad1 UTSW 3 108775192 missense probably damaging 0.99
R0931:Aknad1 UTSW 3 108752023 missense probably damaging 1.00
R1147:Aknad1 UTSW 3 108752541 missense possibly damaging 0.89
R1147:Aknad1 UTSW 3 108752541 missense possibly damaging 0.89
R1179:Aknad1 UTSW 3 108752467 missense possibly damaging 0.78
R1579:Aknad1 UTSW 3 108752136 nonsense probably null
R1746:Aknad1 UTSW 3 108751783 missense possibly damaging 0.48
R2205:Aknad1 UTSW 3 108757293 missense probably damaging 1.00
R2316:Aknad1 UTSW 3 108781156 missense probably damaging 0.98
R2519:Aknad1 UTSW 3 108756468 missense probably damaging 0.97
R3087:Aknad1 UTSW 3 108756863 nonsense probably null
R4007:Aknad1 UTSW 3 108775282 missense probably benign 0.33
R4716:Aknad1 UTSW 3 108775101 critical splice donor site probably null
R4762:Aknad1 UTSW 3 108775231 missense possibly damaging 0.86
R4852:Aknad1 UTSW 3 108751740 missense probably damaging 0.99
R4910:Aknad1 UTSW 3 108781252 critical splice donor site probably null
R5191:Aknad1 UTSW 3 108751990 missense probably benign 0.04
R5191:Aknad1 UTSW 3 108752551 missense probably benign 0.11
R5918:Aknad1 UTSW 3 108752387 missense probably benign 0.00
R6246:Aknad1 UTSW 3 108751832 missense probably damaging 1.00
R7123:Aknad1 UTSW 3 108775244 nonsense probably null
R7641:Aknad1 UTSW 3 108771975 missense probably benign 0.41
R8181:Aknad1 UTSW 3 108752012 missense possibly damaging 0.91
R8377:Aknad1 UTSW 3 108781939 missense possibly damaging 0.53
R8430:Aknad1 UTSW 3 108751721 missense possibly damaging 0.95
X0023:Aknad1 UTSW 3 108752177 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- ATGCTGACAGTCTTGAAGGC -3'
(R):5'- AGAATGGCCGCCTTCGTTAG -3'

Sequencing Primer
(F):5'- GACAGTCTTGAAGGCTCAGATACTC -3'
(R):5'- CCGCCTTCGTTAGCTGTGG -3'
Posted On2018-08-01