Incidental Mutation 'R6730:Myoz2'
ID530006
Institutional Source Beutler Lab
Gene Symbol Myoz2
Ensembl Gene ENSMUSG00000028116
Gene Namemyozenin 2
Synonymscalsarcin-1, 1110012I24Rik, Fatz-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R6730 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location123006206-123035015 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 123016627 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 100 (G100C)
Ref Sequence ENSEMBL: ENSMUSP00000029761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029761] [ENSMUST00000141588]
Predicted Effect probably damaging
Transcript: ENSMUST00000029761
AA Change: G100C

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029761
Gene: ENSMUSG00000028116
AA Change: G100C

DomainStartEndE-ValueType
Pfam:Calsarcin 1 264 1.3e-89 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000103761
Predicted Effect probably benign
Transcript: ENSMUST00000141588
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143464
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200514
Meta Mutation Damage Score 0.1729 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of sarcomeric proteins that bind to calcineurin, a phosphatase involved in calcium-dependent signal transduction in diverse cell types. These family members tether calcineurin to alpha-actinin at the z-line of the sarcomere of cardiac and skeletal muscle cells, and thus they are important for calcineurin signaling. Mutations in this gene cause cardiomyopathy familial hypertrophic type 16, a hereditary heart disorder. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mutants show an excess of skeletal muscle fibers and chronically activated hypertrophic gene program despite the absence of hypertrophy. However, stressed null mutants do form cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930455H04Rik T A 3: 116,983,475 *59R probably null Het
Adam10 G T 9: 70,740,176 probably null Het
Adam2 A T 14: 66,037,576 N569K possibly damaging Het
Adam20 T C 8: 40,796,659 V602A probably benign Het
Adgrb3 T C 1: 25,094,294 Y1237C probably damaging Het
Ago3 T C 4: 126,371,545 T318A probably null Het
Aknad1 G A 3: 108,752,339 G223D possibly damaging Het
Camkv T C 9: 107,948,317 S478P possibly damaging Het
Ccl27a T A 4: 41,773,342 H39L probably damaging Het
Ccser2 C A 14: 36,879,086 S447I probably damaging Het
Clvs2 A G 10: 33,528,521 L233P probably damaging Het
Csn1s2b T A 5: 87,822,268 H124Q probably benign Het
Dnhd1 T C 7: 105,703,875 L2745P probably benign Het
Dync1i2 T A 2: 71,247,140 F219L probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ephb6 C T 6: 41,617,374 Q613* probably null Het
Erc2 A C 14: 27,898,567 D50A possibly damaging Het
Fam149a T A 8: 45,381,174 D196V probably damaging Het
Fam46c T A 3: 100,472,957 N161I probably benign Het
Ficd T C 5: 113,738,712 V316A probably damaging Het
Gstm6 T A 3: 107,942,725 K18* probably null Het
Ighv1-62-1 A T 12: 115,386,892 W52R probably benign Het
Klhl18 C T 9: 110,428,911 C417Y probably damaging Het
Ly9 T A 1: 171,605,169 Y92F probably benign Het
Mettl18 C T 1: 163,997,181 T357I probably damaging Het
Olfr1297 A G 2: 111,621,735 V113A probably damaging Het
Olfr517 A T 7: 108,868,573 F194I probably benign Het
Olfr871 T C 9: 20,212,502 I51T probably benign Het
Pars2 C T 4: 106,653,431 L128F probably damaging Het
Pcsk6 G T 7: 65,980,248 R374L probably damaging Het
Ptpn3 T C 4: 57,270,088 T25A probably benign Het
Rab11fip1 G A 8: 27,143,229 P1150S probably damaging Het
Rabep1 A G 11: 70,940,386 Q831R possibly damaging Het
Rad17 T C 13: 100,649,745 probably benign Het
Rxfp1 T A 3: 79,650,591 R527* probably null Het
Scnn1b C T 7: 121,902,877 P253S probably damaging Het
Skiv2l G A 17: 34,845,190 R507* probably null Het
Slc2a7 T C 4: 150,158,148 F231S probably damaging Het
Svil A G 18: 5,049,311 N196S probably benign Het
Urb1 T C 16: 90,779,083 S862G possibly damaging Het
Usp30 T C 5: 114,103,709 S87P probably damaging Het
Vmn1r177 T A 7: 23,865,812 H213L probably damaging Het
Vmn2r106 T A 17: 20,278,834 I272L possibly damaging Het
Vmn2r120 T A 17: 57,525,012 D259V probably benign Het
Other mutations in Myoz2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Myoz2 APN 3 123016544 splice site probably benign
IGL01417:Myoz2 APN 3 123006432 missense possibly damaging 0.65
IGL01645:Myoz2 APN 3 123034232 missense probably damaging 1.00
IGL01759:Myoz2 APN 3 123013781 missense possibly damaging 0.95
IGL03167:Myoz2 APN 3 123006490 nonsense probably null
R1384:Myoz2 UTSW 3 123026116 missense probably damaging 1.00
R1789:Myoz2 UTSW 3 123026127 missense probably damaging 1.00
R1874:Myoz2 UTSW 3 123026116 missense probably damaging 1.00
R1875:Myoz2 UTSW 3 123026116 missense probably damaging 1.00
R2137:Myoz2 UTSW 3 123034212 missense probably benign 0.00
R3881:Myoz2 UTSW 3 123013720 missense probably damaging 0.98
R8265:Myoz2 UTSW 3 123006523 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- GGAATAGCATGGACCATCTGAAAC -3'
(R):5'- CCGTGTAAATCCCTGAGGTC -3'

Sequencing Primer
(F):5'- TGGACCATCTGAAACAACATATAAC -3'
(R):5'- TAAATCCCTGAGGTCCCGGG -3'
Posted On2018-08-01