Incidental Mutation 'R6730:Ptpn3'
List |< first << previous [record 32 of 45] next >> last >|
ID530008
Institutional Source Beutler Lab
Gene Symbol Ptpn3
Ensembl Gene ENSMUSG00000038764
Gene Nameprotein tyrosine phosphatase, non-receptor type 3
Synonyms9530011I20Rik, PTPCL, PTP-H1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.361) question?
Stock #R6730 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location57190841-57301837 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57270088 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 25 (T25A)
Ref Sequence ENSEMBL: ENSMUSP00000122490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075637] [ENSMUST00000130900] [ENSMUST00000151964] [ENSMUST00000153926]
Predicted Effect probably benign
Transcript: ENSMUST00000075637
AA Change: T25A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000075063
Gene: ENSMUSG00000038764
AA Change: T25A

DomainStartEndE-ValueType
B41 25 222 2.44e-67 SMART
FERM_C 226 316 2.64e-25 SMART
low complexity region 454 470 N/A INTRINSIC
PDZ 519 598 1.65e-15 SMART
PTPc 645 903 5.66e-117 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130900
AA Change: T25A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114805
Gene: ENSMUSG00000038764
AA Change: T25A

DomainStartEndE-ValueType
Blast:B41 25 57 1e-15 BLAST
SCOP:d1gg3a3 31 57 2e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150445
Predicted Effect probably benign
Transcript: ENSMUST00000151964
AA Change: T25A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000153926
AA Change: T25A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122490
Gene: ENSMUSG00000038764
AA Change: T25A

DomainStartEndE-ValueType
B41 25 222 2.44e-67 SMART
Meta Mutation Damage Score 0.0586 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This protein contains a C-terminal PTP domain and an N-terminal domain homologous to the band 4.1 superfamily of cytoskeletal-associated proteins. P97, a cell cycle regulator involved in a variety of membrane related functions, has been shown to be a substrate of this PTP. This PTP was also found to interact with, and be regulated by adaptor protein 14-3-3 beta. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit increased body weight, especially in males, and male mice exhibit increased bone mineral content. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930455H04Rik T A 3: 116,983,475 *59R probably null Het
Adam10 G T 9: 70,740,176 probably null Het
Adam2 A T 14: 66,037,576 N569K possibly damaging Het
Adam20 T C 8: 40,796,659 V602A probably benign Het
Adgrb3 T C 1: 25,094,294 Y1237C probably damaging Het
Ago3 T C 4: 126,371,545 T318A probably null Het
Aknad1 G A 3: 108,752,339 G223D possibly damaging Het
Camkv T C 9: 107,948,317 S478P possibly damaging Het
Ccl27a T A 4: 41,773,342 H39L probably damaging Het
Ccser2 C A 14: 36,879,086 S447I probably damaging Het
Clvs2 A G 10: 33,528,521 L233P probably damaging Het
Csn1s2b T A 5: 87,822,268 H124Q probably benign Het
Dnhd1 T C 7: 105,703,875 L2745P probably benign Het
Dync1i2 T A 2: 71,247,140 F219L probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ephb6 C T 6: 41,617,374 Q613* probably null Het
Erc2 A C 14: 27,898,567 D50A possibly damaging Het
Fam149a T A 8: 45,381,174 D196V probably damaging Het
Fam46c T A 3: 100,472,957 N161I probably benign Het
Ficd T C 5: 113,738,712 V316A probably damaging Het
Gstm6 T A 3: 107,942,725 K18* probably null Het
Ighv1-62-1 A T 12: 115,386,892 W52R probably benign Het
Klhl18 C T 9: 110,428,911 C417Y probably damaging Het
Ly9 T A 1: 171,605,169 Y92F probably benign Het
Mettl18 C T 1: 163,997,181 T357I probably damaging Het
Myoz2 C A 3: 123,016,627 G100C probably damaging Het
Olfr1297 A G 2: 111,621,735 V113A probably damaging Het
Olfr517 A T 7: 108,868,573 F194I probably benign Het
Olfr871 T C 9: 20,212,502 I51T probably benign Het
Pars2 C T 4: 106,653,431 L128F probably damaging Het
Pcsk6 G T 7: 65,980,248 R374L probably damaging Het
Rab11fip1 G A 8: 27,143,229 P1150S probably damaging Het
Rabep1 A G 11: 70,940,386 Q831R possibly damaging Het
Rad17 T C 13: 100,649,745 probably benign Het
Rxfp1 T A 3: 79,650,591 R527* probably null Het
Scnn1b C T 7: 121,902,877 P253S probably damaging Het
Skiv2l G A 17: 34,845,190 R507* probably null Het
Slc2a7 T C 4: 150,158,148 F231S probably damaging Het
Svil A G 18: 5,049,311 N196S probably benign Het
Urb1 T C 16: 90,779,083 S862G possibly damaging Het
Usp30 T C 5: 114,103,709 S87P probably damaging Het
Vmn1r177 T A 7: 23,865,812 H213L probably damaging Het
Vmn2r106 T A 17: 20,278,834 I272L possibly damaging Het
Vmn2r120 T A 17: 57,525,012 D259V probably benign Het
Other mutations in Ptpn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Ptpn3 APN 4 57270050 missense possibly damaging 0.95
IGL01090:Ptpn3 APN 4 57240833 missense probably damaging 1.00
IGL01399:Ptpn3 APN 4 57225775 missense probably benign 0.01
IGL01413:Ptpn3 APN 4 57270156 missense probably damaging 0.96
IGL01418:Ptpn3 APN 4 57270156 missense probably damaging 0.96
IGL01806:Ptpn3 APN 4 57254915 critical splice donor site probably null
IGL01933:Ptpn3 APN 4 57197576 missense probably benign 0.00
IGL02087:Ptpn3 APN 4 57222019 missense probably damaging 1.00
IGL02269:Ptpn3 APN 4 57197510 missense possibly damaging 0.72
IGL02413:Ptpn3 APN 4 57205020 missense probably damaging 1.00
IGL03163:Ptpn3 APN 4 57222020 missense probably damaging 1.00
R0179:Ptpn3 UTSW 4 57270118 missense probably benign 0.00
R0240:Ptpn3 UTSW 4 57232374 missense probably benign
R0240:Ptpn3 UTSW 4 57232374 missense probably benign
R0310:Ptpn3 UTSW 4 57204958 missense probably benign 0.00
R0492:Ptpn3 UTSW 4 57194304 missense probably benign
R0631:Ptpn3 UTSW 4 57204921 missense probably damaging 0.99
R0656:Ptpn3 UTSW 4 57270075 missense probably benign 0.41
R1443:Ptpn3 UTSW 4 57225775 missense probably benign 0.01
R1741:Ptpn3 UTSW 4 57254922 missense probably damaging 1.00
R1856:Ptpn3 UTSW 4 57239682 missense probably damaging 1.00
R3753:Ptpn3 UTSW 4 57270144 missense probably damaging 1.00
R4431:Ptpn3 UTSW 4 57235355 missense probably damaging 0.97
R4704:Ptpn3 UTSW 4 57270119 missense possibly damaging 0.79
R4935:Ptpn3 UTSW 4 57197568 missense probably damaging 1.00
R5119:Ptpn3 UTSW 4 57218513 missense possibly damaging 0.93
R5410:Ptpn3 UTSW 4 57205019 missense probably damaging 1.00
R5554:Ptpn3 UTSW 4 57240843 missense probably damaging 0.99
R6024:Ptpn3 UTSW 4 57248653 splice site probably null
R6061:Ptpn3 UTSW 4 57248681 missense probably damaging 1.00
R6212:Ptpn3 UTSW 4 57270070 missense probably damaging 1.00
R6213:Ptpn3 UTSW 4 57265012 missense probably damaging 1.00
R6239:Ptpn3 UTSW 4 57249981 missense probably benign
R6444:Ptpn3 UTSW 4 57195730 missense possibly damaging 0.51
R6606:Ptpn3 UTSW 4 57265104 splice site probably null
R6656:Ptpn3 UTSW 4 57205905 missense probably damaging 0.99
R7133:Ptpn3 UTSW 4 57225863 missense probably benign 0.30
R7231:Ptpn3 UTSW 4 57245062 missense probably damaging 1.00
R7237:Ptpn3 UTSW 4 57239625 missense probably damaging 1.00
R7368:Ptpn3 UTSW 4 57221993 missense probably damaging 1.00
R7604:Ptpn3 UTSW 4 57240845 missense probably damaging 0.99
R7742:Ptpn3 UTSW 4 57265092 critical splice acceptor site probably null
R8023:Ptpn3 UTSW 4 57248688 missense probably benign 0.02
R8099:Ptpn3 UTSW 4 57204985 nonsense probably null
R8155:Ptpn3 UTSW 4 57232336 missense probably benign
R8302:Ptpn3 UTSW 4 57218514 missense probably benign 0.01
R8315:Ptpn3 UTSW 4 57270063 missense possibly damaging 0.88
R8335:Ptpn3 UTSW 4 57235286 missense probably damaging 0.99
R8346:Ptpn3 UTSW 4 57225547 missense probably damaging 0.99
R8348:Ptpn3 UTSW 4 57240784 critical splice donor site probably null
R8448:Ptpn3 UTSW 4 57240784 critical splice donor site probably null
R8513:Ptpn3 UTSW 4 57270085 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGCCAGTTCTGAAATTTCAAGC -3'
(R):5'- AAAGATGGTTTTGTTACCCTGC -3'

Sequencing Primer
(F):5'- GCCAGTTCTGAAATTTCAAGCTTTCC -3'
(R):5'- CTGATGCTGTGAGGAGCCAG -3'
Posted On2018-08-01