Incidental Mutation 'R6730:Pars2'
ID530009
Institutional Source Beutler Lab
Gene Symbol Pars2
Ensembl Gene ENSMUSG00000043572
Gene Nameprolyl-tRNA synthetase (mitochondrial)(putative)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.897) question?
Stock #R6730 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location106651069-106655282 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 106653431 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 128 (L128F)
Ref Sequence ENSEMBL: ENSMUSP00000102394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058905] [ENSMUST00000106781] [ENSMUST00000106782]
Predicted Effect probably damaging
Transcript: ENSMUST00000058905
AA Change: L101F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053160
Gene: ENSMUSG00000043572
AA Change: L101F

DomainStartEndE-ValueType
Pfam:tRNA-synt_2b 98 268 4.8e-36 PFAM
Pfam:HGTP_anticodon 371 470 8.7e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106781
AA Change: L137F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102393
Gene: ENSMUSG00000043572
AA Change: L137F

DomainStartEndE-ValueType
Pfam:tRNA-synt_2b 178 391 4.1e-36 PFAM
Pfam:HGTP_anticodon 407 506 3.9e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106782
AA Change: L128F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102394
Gene: ENSMUSG00000043572
AA Change: L128F

DomainStartEndE-ValueType
PDB:2I4O|C 63 162 2e-8 PDB
SCOP:d1atia2 95 162 4e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146966
Meta Mutation Damage Score 0.3324 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative member of the class II family of aminoacyl-tRNA synthetases. These enzymes play a critical role in protein biosynthesis by charging tRNAs with their cognate amino acids. This protein is encoded by the nuclear genome but is likely to be imported to the mitochondrion where it is thought to catalyze the ligation of proline to tRNA molecules. Mutations have been found in this gene in some patients with Alpers syndrome. [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930455H04Rik T A 3: 116,983,475 *59R probably null Het
Adam10 G T 9: 70,740,176 probably null Het
Adam2 A T 14: 66,037,576 N569K possibly damaging Het
Adam20 T C 8: 40,796,659 V602A probably benign Het
Adgrb3 T C 1: 25,094,294 Y1237C probably damaging Het
Ago3 T C 4: 126,371,545 T318A probably null Het
Aknad1 G A 3: 108,752,339 G223D possibly damaging Het
Camkv T C 9: 107,948,317 S478P possibly damaging Het
Ccl27a T A 4: 41,773,342 H39L probably damaging Het
Ccser2 C A 14: 36,879,086 S447I probably damaging Het
Clvs2 A G 10: 33,528,521 L233P probably damaging Het
Csn1s2b T A 5: 87,822,268 H124Q probably benign Het
Dnhd1 T C 7: 105,703,875 L2745P probably benign Het
Dync1i2 T A 2: 71,247,140 F219L probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ephb6 C T 6: 41,617,374 Q613* probably null Het
Erc2 A C 14: 27,898,567 D50A possibly damaging Het
Fam149a T A 8: 45,381,174 D196V probably damaging Het
Fam46c T A 3: 100,472,957 N161I probably benign Het
Ficd T C 5: 113,738,712 V316A probably damaging Het
Gstm6 T A 3: 107,942,725 K18* probably null Het
Ighv1-62-1 A T 12: 115,386,892 W52R probably benign Het
Klhl18 C T 9: 110,428,911 C417Y probably damaging Het
Ly9 T A 1: 171,605,169 Y92F probably benign Het
Mettl18 C T 1: 163,997,181 T357I probably damaging Het
Myoz2 C A 3: 123,016,627 G100C probably damaging Het
Olfr1297 A G 2: 111,621,735 V113A probably damaging Het
Olfr517 A T 7: 108,868,573 F194I probably benign Het
Olfr871 T C 9: 20,212,502 I51T probably benign Het
Pcsk6 G T 7: 65,980,248 R374L probably damaging Het
Ptpn3 T C 4: 57,270,088 T25A probably benign Het
Rab11fip1 G A 8: 27,143,229 P1150S probably damaging Het
Rabep1 A G 11: 70,940,386 Q831R possibly damaging Het
Rad17 T C 13: 100,649,745 probably benign Het
Rxfp1 T A 3: 79,650,591 R527* probably null Het
Scnn1b C T 7: 121,902,877 P253S probably damaging Het
Skiv2l G A 17: 34,845,190 R507* probably null Het
Slc2a7 T C 4: 150,158,148 F231S probably damaging Het
Svil A G 18: 5,049,311 N196S probably benign Het
Urb1 T C 16: 90,779,083 S862G possibly damaging Het
Usp30 T C 5: 114,103,709 S87P probably damaging Het
Vmn1r177 T A 7: 23,865,812 H213L probably damaging Het
Vmn2r106 T A 17: 20,278,834 I272L possibly damaging Het
Vmn2r120 T A 17: 57,525,012 D259V probably benign Het
Other mutations in Pars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Pars2 APN 4 106654050 missense probably damaging 0.99
IGL03358:Pars2 APN 4 106653042 missense probably benign 0.00
PIT4378001:Pars2 UTSW 4 106654293 missense possibly damaging 0.51
R1384:Pars2 UTSW 4 106653716 missense possibly damaging 0.75
R1874:Pars2 UTSW 4 106653716 missense possibly damaging 0.75
R1875:Pars2 UTSW 4 106653716 missense possibly damaging 0.75
R2041:Pars2 UTSW 4 106653617 missense probably damaging 1.00
R4606:Pars2 UTSW 4 106654050 missense probably benign 0.22
R4790:Pars2 UTSW 4 106651111 utr 5 prime probably benign
R4794:Pars2 UTSW 4 106654210 nonsense probably null
R5162:Pars2 UTSW 4 106654538 missense probably benign 0.00
R6066:Pars2 UTSW 4 106654079 missense probably damaging 1.00
R6860:Pars2 UTSW 4 106654503 missense probably benign 0.45
R7710:Pars2 UTSW 4 106654079 missense probably damaging 1.00
R7712:Pars2 UTSW 4 106654079 missense probably damaging 1.00
R7817:Pars2 UTSW 4 106654079 missense probably damaging 1.00
R7870:Pars2 UTSW 4 106654079 missense probably damaging 1.00
Z1177:Pars2 UTSW 4 106653099 missense probably benign 0.00
Z1177:Pars2 UTSW 4 106654446 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCGCTTGGTATTATCCCGC -3'
(R):5'- AGTTTCTTCTGGGAGGCAAC -3'

Sequencing Primer
(F):5'- GGTATTATCCCGCATGTTCCAG -3'
(R):5'- AACCGCTTCCTCATGAGTCGG -3'
Posted On2018-08-01