Incidental Mutation 'R6730:Slc2a7'
ID530011
Institutional Source Beutler Lab
Gene Symbol Slc2a7
Ensembl Gene ENSMUSG00000062064
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 7
SynonymsOTTMUSG00000010396
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R6730 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location150148972-150168482 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 150158148 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 231 (F231S)
Ref Sequence ENSEMBL: ENSMUSP00000059106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059893]
Predicted Effect probably damaging
Transcript: ENSMUST00000059893
AA Change: F231S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059106
Gene: ENSMUSG00000062064
AA Change: F231S

DomainStartEndE-ValueType
Pfam:MFS_1 22 319 2e-15 PFAM
Pfam:Sugar_tr 26 494 7.6e-120 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133379
Meta Mutation Damage Score 0.6281 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC2A7 belongs to a family of transporters that catalyze the uptake of sugars through facilitated diffusion (Li et al., 2004). This family of transporters shows conservation of 12 transmembrane helices as well as functionally significant amino acid residues (Joost and Thorens, 2001 [PubMed 11780753]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930455H04Rik T A 3: 116,983,475 *59R probably null Het
Adam10 G T 9: 70,740,176 probably null Het
Adam2 A T 14: 66,037,576 N569K possibly damaging Het
Adam20 T C 8: 40,796,659 V602A probably benign Het
Adgrb3 T C 1: 25,094,294 Y1237C probably damaging Het
Ago3 T C 4: 126,371,545 T318A probably null Het
Aknad1 G A 3: 108,752,339 G223D possibly damaging Het
Camkv T C 9: 107,948,317 S478P possibly damaging Het
Ccl27a T A 4: 41,773,342 H39L probably damaging Het
Ccser2 C A 14: 36,879,086 S447I probably damaging Het
Clvs2 A G 10: 33,528,521 L233P probably damaging Het
Csn1s2b T A 5: 87,822,268 H124Q probably benign Het
Dnhd1 T C 7: 105,703,875 L2745P probably benign Het
Dync1i2 T A 2: 71,247,140 F219L probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ephb6 C T 6: 41,617,374 Q613* probably null Het
Erc2 A C 14: 27,898,567 D50A possibly damaging Het
Fam149a T A 8: 45,381,174 D196V probably damaging Het
Fam46c T A 3: 100,472,957 N161I probably benign Het
Ficd T C 5: 113,738,712 V316A probably damaging Het
Gstm6 T A 3: 107,942,725 K18* probably null Het
Ighv1-62-1 A T 12: 115,386,892 W52R probably benign Het
Klhl18 C T 9: 110,428,911 C417Y probably damaging Het
Ly9 T A 1: 171,605,169 Y92F probably benign Het
Mettl18 C T 1: 163,997,181 T357I probably damaging Het
Myoz2 C A 3: 123,016,627 G100C probably damaging Het
Olfr1297 A G 2: 111,621,735 V113A probably damaging Het
Olfr517 A T 7: 108,868,573 F194I probably benign Het
Olfr871 T C 9: 20,212,502 I51T probably benign Het
Pars2 C T 4: 106,653,431 L128F probably damaging Het
Pcsk6 G T 7: 65,980,248 R374L probably damaging Het
Ptpn3 T C 4: 57,270,088 T25A probably benign Het
Rab11fip1 G A 8: 27,143,229 P1150S probably damaging Het
Rabep1 A G 11: 70,940,386 Q831R possibly damaging Het
Rad17 T C 13: 100,649,745 probably benign Het
Rxfp1 T A 3: 79,650,591 R527* probably null Het
Scnn1b C T 7: 121,902,877 P253S probably damaging Het
Skiv2l G A 17: 34,845,190 R507* probably null Het
Svil A G 18: 5,049,311 N196S probably benign Het
Urb1 T C 16: 90,779,083 S862G possibly damaging Het
Usp30 T C 5: 114,103,709 S87P probably damaging Het
Vmn1r177 T A 7: 23,865,812 H213L probably damaging Het
Vmn2r106 T A 17: 20,278,834 I272L possibly damaging Het
Vmn2r120 T A 17: 57,525,012 D259V probably benign Het
Other mutations in Slc2a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Slc2a7 APN 4 150157564 missense probably damaging 1.00
IGL01990:Slc2a7 APN 4 150154684 missense possibly damaging 0.89
IGL02480:Slc2a7 APN 4 150160112 missense possibly damaging 0.93
IGL02607:Slc2a7 APN 4 150154705 missense probably benign
IGL02716:Slc2a7 APN 4 150160010 splice site probably benign
IGL02861:Slc2a7 APN 4 150168379 missense probably benign 0.16
IGL03343:Slc2a7 APN 4 150168340 missense probably damaging 1.00
R0116:Slc2a7 UTSW 4 150168264 missense probably benign 0.31
R0302:Slc2a7 UTSW 4 150149521 missense probably damaging 0.99
R0309:Slc2a7 UTSW 4 150158071 splice site probably benign
R0367:Slc2a7 UTSW 4 150166366 missense probably benign 0.03
R1485:Slc2a7 UTSW 4 150166396 missense probably damaging 1.00
R1542:Slc2a7 UTSW 4 150168471 missense probably damaging 1.00
R1544:Slc2a7 UTSW 4 150154686 missense probably damaging 1.00
R3973:Slc2a7 UTSW 4 150158210 splice site probably null
R4399:Slc2a7 UTSW 4 150158550 missense probably damaging 1.00
R4467:Slc2a7 UTSW 4 150163274 missense possibly damaging 0.95
R4712:Slc2a7 UTSW 4 150168469 missense probably benign 0.00
R5066:Slc2a7 UTSW 4 150160116 missense probably damaging 1.00
R5510:Slc2a7 UTSW 4 150160094 missense probably benign 0.00
R5995:Slc2a7 UTSW 4 150168340 missense probably damaging 1.00
R6017:Slc2a7 UTSW 4 150165172 missense probably damaging 0.99
R6062:Slc2a7 UTSW 4 150168427 missense probably benign
R6185:Slc2a7 UTSW 4 150148993 missense probably benign 0.00
R7753:Slc2a7 UTSW 4 150154684 missense possibly damaging 0.89
R8145:Slc2a7 UTSW 4 150168361 missense probably damaging 1.00
R8203:Slc2a7 UTSW 4 150158558 nonsense probably null
R8512:Slc2a7 UTSW 4 150163295 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- ATCTTGGCAAGGACTAGGTGG -3'
(R):5'- AAAGCTCAGGCCTCATACGC -3'

Sequencing Primer
(F):5'- ACCCTCGTTTATCACCTGGTTAG -3'
(R):5'- AGTCACCACTGCTCACCCTG -3'
Posted On2018-08-01