Incidental Mutation 'R6730:Csn1s2b'
List |< first << previous [record 12 of 45] next >> last >|
ID530012
Institutional Source Beutler Lab
Gene Symbol Csn1s2b
Ensembl Gene ENSMUSG00000061388
Gene Namecasein alpha s2-like B
SynonymsCsnd, Csne
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R6730 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location87808082-87824426 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87822268 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 124 (H124Q)
Ref Sequence ENSEMBL: ENSMUSP00000072352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002310] [ENSMUST00000072539] [ENSMUST00000101056] [ENSMUST00000101057] [ENSMUST00000113279] [ENSMUST00000197301]
Predicted Effect probably benign
Transcript: ENSMUST00000002310
SMART Domains Protein: ENSMUSP00000002310
Gene: ENSMUSG00000002240

DomainStartEndE-ValueType
low complexity region 49 57 N/A INTRINSIC
low complexity region 104 130 N/A INTRINSIC
low complexity region 137 153 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072539
AA Change: H124Q

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000072352
Gene: ENSMUSG00000061388
AA Change: H124Q

DomainStartEndE-ValueType
Pfam:Casein 58 136 4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101056
SMART Domains Protein: ENSMUSP00000098617
Gene: ENSMUSG00000002240

DomainStartEndE-ValueType
low complexity region 57 65 N/A INTRINSIC
low complexity region 112 138 N/A INTRINSIC
low complexity region 145 161 N/A INTRINSIC
low complexity region 187 202 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101057
Predicted Effect probably benign
Transcript: ENSMUST00000113279
AA Change: H119Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108904
Gene: ENSMUSG00000061388
AA Change: H119Q

DomainStartEndE-ValueType
Pfam:Casein 55 133 5.1e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197301
AA Change: H113Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142449
Gene: ENSMUSG00000061388
AA Change: H113Q

DomainStartEndE-ValueType
Pfam:Casein 45 127 7.2e-15 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: This gene is a member of the alpha-s2-like casein gene family, and this gene product is a calcium-sensitive casein. Members of this gene family are organized as a gene cluster that is conserved in its order, but with greater conservation amongst orthologs than paralogs. The protein encoded by this gene interacts with other casein proteins to form a micelle structure, and is a major source of protein in milk. This structure is important for the transport of calcium, phosphate, and protein. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930455H04Rik T A 3: 116,983,475 *59R probably null Het
Adam10 G T 9: 70,740,176 probably null Het
Adam2 A T 14: 66,037,576 N569K possibly damaging Het
Adam20 T C 8: 40,796,659 V602A probably benign Het
Adgrb3 T C 1: 25,094,294 Y1237C probably damaging Het
Ago3 T C 4: 126,371,545 T318A probably null Het
Aknad1 G A 3: 108,752,339 G223D possibly damaging Het
Camkv T C 9: 107,948,317 S478P possibly damaging Het
Ccl27a T A 4: 41,773,342 H39L probably damaging Het
Ccser2 C A 14: 36,879,086 S447I probably damaging Het
Clvs2 A G 10: 33,528,521 L233P probably damaging Het
Dnhd1 T C 7: 105,703,875 L2745P probably benign Het
Dync1i2 T A 2: 71,247,140 F219L probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ephb6 C T 6: 41,617,374 Q613* probably null Het
Erc2 A C 14: 27,898,567 D50A possibly damaging Het
Fam149a T A 8: 45,381,174 D196V probably damaging Het
Fam46c T A 3: 100,472,957 N161I probably benign Het
Ficd T C 5: 113,738,712 V316A probably damaging Het
Gstm6 T A 3: 107,942,725 K18* probably null Het
Ighv1-62-1 A T 12: 115,386,892 W52R probably benign Het
Klhl18 C T 9: 110,428,911 C417Y probably damaging Het
Ly9 T A 1: 171,605,169 Y92F probably benign Het
Mettl18 C T 1: 163,997,181 T357I probably damaging Het
Myoz2 C A 3: 123,016,627 G100C probably damaging Het
Olfr1297 A G 2: 111,621,735 V113A probably damaging Het
Olfr517 A T 7: 108,868,573 F194I probably benign Het
Olfr871 T C 9: 20,212,502 I51T probably benign Het
Pars2 C T 4: 106,653,431 L128F probably damaging Het
Pcsk6 G T 7: 65,980,248 R374L probably damaging Het
Ptpn3 T C 4: 57,270,088 T25A probably benign Het
Rab11fip1 G A 8: 27,143,229 P1150S probably damaging Het
Rabep1 A G 11: 70,940,386 Q831R possibly damaging Het
Rad17 T C 13: 100,649,745 probably benign Het
Rxfp1 T A 3: 79,650,591 R527* probably null Het
Scnn1b C T 7: 121,902,877 P253S probably damaging Het
Skiv2l G A 17: 34,845,190 R507* probably null Het
Slc2a7 T C 4: 150,158,148 F231S probably damaging Het
Svil A G 18: 5,049,311 N196S probably benign Het
Urb1 T C 16: 90,779,083 S862G possibly damaging Het
Usp30 T C 5: 114,103,709 S87P probably damaging Het
Vmn1r177 T A 7: 23,865,812 H213L probably damaging Het
Vmn2r106 T A 17: 20,278,834 I272L possibly damaging Het
Vmn2r120 T A 17: 57,525,012 D259V probably benign Het
Other mutations in Csn1s2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01559:Csn1s2b APN 5 87820951 nonsense probably null
IGL01704:Csn1s2b APN 5 87813111 missense probably damaging 1.00
IGL01785:Csn1s2b APN 5 87809913 missense possibly damaging 0.91
IGL02689:Csn1s2b APN 5 87809921 missense probably benign 0.41
R1596:Csn1s2b UTSW 5 87819058 splice site probably benign
R1649:Csn1s2b UTSW 5 87819084 missense probably benign 0.07
R1682:Csn1s2b UTSW 5 87822303 missense probably damaging 0.98
R1747:Csn1s2b UTSW 5 87816670 splice site probably benign
R3123:Csn1s2b UTSW 5 87819058 splice site probably benign
R4667:Csn1s2b UTSW 5 87822311 missense possibly damaging 0.53
R4781:Csn1s2b UTSW 5 87819093 missense possibly damaging 0.77
R4965:Csn1s2b UTSW 5 87813961 missense possibly damaging 0.81
R6013:Csn1s2b UTSW 5 87824239 splice site probably null
R8028:Csn1s2b UTSW 5 87819092 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTGAATGTACCCTCTGAGCTATG -3'
(R):5'- ATGGGTCATCATTTTCTGCTTTAGC -3'

Sequencing Primer
(F):5'- GCTATGTTTGTTTTAATAAAGAGCCC -3'
(R):5'- CCATTCCTAGAAAAACTGTGAG -3'
Posted On2018-08-01