Incidental Mutation 'R6730:Usp30'
ID530014
Institutional Source Beutler Lab
Gene Symbol Usp30
Ensembl Gene ENSMUSG00000029592
Gene Nameubiquitin specific peptidase 30
SynonymsD5Ertd483e, 6330590F17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6730 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location114065461-114124720 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 114103709 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 87 (S87P)
Ref Sequence ENSEMBL: ENSMUSP00000031588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031588] [ENSMUST00000200119] [ENSMUST00000202603]
Predicted Effect probably damaging
Transcript: ENSMUST00000031588
AA Change: S87P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031588
Gene: ENSMUSG00000029592
AA Change: S87P

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
transmembrane domain 35 57 N/A INTRINSIC
Pfam:UCH 67 499 2.6e-44 PFAM
Pfam:UCH_1 68 481 8.8e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196574
Predicted Effect probably damaging
Transcript: ENSMUST00000200119
AA Change: S87P

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142350
Gene: ENSMUSG00000029592
AA Change: S87P

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
transmembrane domain 35 57 N/A INTRINSIC
Pfam:UCH 67 368 2.9e-31 PFAM
Pfam:UCH_1 68 376 1e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000202603
AA Change: S71P

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144522
Gene: ENSMUSG00000029592
AA Change: S71P

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:UCH 51 144 5.8e-11 PFAM
Meta Mutation Damage Score 0.8593 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] USP30, a member of the ubiquitin-specific protease family (see USP1, MIM 603478), is a novel mitochondrial deubiquitinating (DUB) enzyme (Nakamura and Hirose, 2008 [PubMed 18287522]).[supplied by OMIM, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930455H04Rik T A 3: 116,983,475 *59R probably null Het
Adam10 G T 9: 70,740,176 probably null Het
Adam2 A T 14: 66,037,576 N569K possibly damaging Het
Adam20 T C 8: 40,796,659 V602A probably benign Het
Adgrb3 T C 1: 25,094,294 Y1237C probably damaging Het
Ago3 T C 4: 126,371,545 T318A probably null Het
Aknad1 G A 3: 108,752,339 G223D possibly damaging Het
Camkv T C 9: 107,948,317 S478P possibly damaging Het
Ccl27a T A 4: 41,773,342 H39L probably damaging Het
Ccser2 C A 14: 36,879,086 S447I probably damaging Het
Clvs2 A G 10: 33,528,521 L233P probably damaging Het
Csn1s2b T A 5: 87,822,268 H124Q probably benign Het
Dnhd1 T C 7: 105,703,875 L2745P probably benign Het
Dync1i2 T A 2: 71,247,140 F219L probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ephb6 C T 6: 41,617,374 Q613* probably null Het
Erc2 A C 14: 27,898,567 D50A possibly damaging Het
Fam149a T A 8: 45,381,174 D196V probably damaging Het
Fam46c T A 3: 100,472,957 N161I probably benign Het
Ficd T C 5: 113,738,712 V316A probably damaging Het
Gstm6 T A 3: 107,942,725 K18* probably null Het
Ighv1-62-1 A T 12: 115,386,892 W52R probably benign Het
Klhl18 C T 9: 110,428,911 C417Y probably damaging Het
Ly9 T A 1: 171,605,169 Y92F probably benign Het
Mettl18 C T 1: 163,997,181 T357I probably damaging Het
Myoz2 C A 3: 123,016,627 G100C probably damaging Het
Olfr1297 A G 2: 111,621,735 V113A probably damaging Het
Olfr517 A T 7: 108,868,573 F194I probably benign Het
Olfr871 T C 9: 20,212,502 I51T probably benign Het
Pars2 C T 4: 106,653,431 L128F probably damaging Het
Pcsk6 G T 7: 65,980,248 R374L probably damaging Het
Ptpn3 T C 4: 57,270,088 T25A probably benign Het
Rab11fip1 G A 8: 27,143,229 P1150S probably damaging Het
Rabep1 A G 11: 70,940,386 Q831R possibly damaging Het
Rad17 T C 13: 100,649,745 probably benign Het
Rxfp1 T A 3: 79,650,591 R527* probably null Het
Scnn1b C T 7: 121,902,877 P253S probably damaging Het
Skiv2l G A 17: 34,845,190 R507* probably null Het
Slc2a7 T C 4: 150,158,148 F231S probably damaging Het
Svil A G 18: 5,049,311 N196S probably benign Het
Urb1 T C 16: 90,779,083 S862G possibly damaging Het
Vmn1r177 T A 7: 23,865,812 H213L probably damaging Het
Vmn2r106 T A 17: 20,278,834 I272L possibly damaging Het
Vmn2r120 T A 17: 57,525,012 D259V probably benign Het
Other mutations in Usp30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03353:Usp30 APN 5 114121058 missense probably benign 0.00
IGL03384:Usp30 APN 5 114121574 missense probably damaging 1.00
R0095:Usp30 UTSW 5 114105840 missense probably damaging 1.00
R0972:Usp30 UTSW 5 114111864 splice site probably benign
R1184:Usp30 UTSW 5 114103827 critical splice donor site probably null
R1589:Usp30 UTSW 5 114112961 missense probably damaging 1.00
R1678:Usp30 UTSW 5 114121146 missense probably damaging 1.00
R2127:Usp30 UTSW 5 114111163 missense probably damaging 1.00
R2129:Usp30 UTSW 5 114111163 missense probably damaging 1.00
R2341:Usp30 UTSW 5 114111180 nonsense probably null
R4677:Usp30 UTSW 5 114119644 missense probably damaging 1.00
R5191:Usp30 UTSW 5 114065694 start gained probably benign
R5956:Usp30 UTSW 5 114119621 missense possibly damaging 0.89
R6947:Usp30 UTSW 5 114103760 missense probably benign 0.01
R7572:Usp30 UTSW 5 114120247 missense probably benign 0.15
R7653:Usp30 UTSW 5 114121669 missense probably damaging 1.00
R7654:Usp30 UTSW 5 114102445 missense probably damaging 1.00
R7794:Usp30 UTSW 5 114112972 nonsense probably null
R8063:Usp30 UTSW 5 114100463 missense probably benign 0.01
R8100:Usp30 UTSW 5 114111184 missense probably damaging 1.00
R8393:Usp30 UTSW 5 114121765 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTGAGGGCTCCATGCATAG -3'
(R):5'- CTTAGGTTCTCAGTGCACACC -3'

Sequencing Primer
(F):5'- CATAGATGCCGGGTCCCAGAAG -3'
(R):5'- CACAACGTCTTTTCCTACAAAGTGG -3'
Posted On2018-08-01