Incidental Mutation 'R6730:Ephb6'
ID530015
Institutional Source Beutler Lab
Gene Symbol Ephb6
Ensembl Gene ENSMUSG00000029869
Gene NameEph receptor B6
SynonymsCekl, Mep
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.687) question?
Stock #R6730 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location41605482-41620509 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 41617374 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 613 (Q613*)
Ref Sequence ENSEMBL: ENSMUSP00000110380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031902] [ENSMUST00000114732] [ENSMUST00000201471]
Predicted Effect probably benign
Transcript: ENSMUST00000031902
SMART Domains Protein: ENSMUSP00000031902
Gene: ENSMUSG00000029868

DomainStartEndE-ValueType
ANK 44 74 2.39e2 SMART
ANK 78 107 6.17e-1 SMART
ANK 116 145 3.06e-5 SMART
ANK 162 191 1.85e-4 SMART
Blast:ANK 195 223 3e-10 BLAST
ANK 238 267 2.47e2 SMART
Pfam:Ion_trans 327 589 9.8e-18 PFAM
low complexity region 680 695 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114732
AA Change: Q613*
SMART Domains Protein: ENSMUSP00000110380
Gene: ENSMUSG00000029869
AA Change: Q613*

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
EPH_lbd 34 227 2.18e-100 SMART
low complexity region 242 255 N/A INTRINSIC
Pfam:GCC2_GCC3 299 341 1.9e-9 PFAM
FN3 365 462 3.59e-3 SMART
FN3 481 562 3.73e-10 SMART
Pfam:EphA2_TM 589 660 3.4e-16 PFAM
Pfam:Pkinase 663 908 1.4e-29 PFAM
Pfam:Pkinase_Tyr 663 908 1.1e-67 PFAM
SAM 938 1005 1e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167082
Predicted Effect probably benign
Transcript: ENSMUST00000167497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170624
Predicted Effect probably benign
Transcript: ENSMUST00000201471
SMART Domains Protein: ENSMUSP00000143854
Gene: ENSMUSG00000029868

DomainStartEndE-ValueType
ANK 44 74 2.39e2 SMART
ANK 78 107 6.17e-1 SMART
ANK 116 145 3.06e-5 SMART
ANK 162 191 1.85e-4 SMART
Blast:ANK 195 223 3e-10 BLAST
ANK 238 267 2.47e2 SMART
Pfam:Ion_trans 327 589 9.8e-18 PFAM
low complexity region 680 695 N/A INTRINSIC
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of transmembrane proteins that function as receptors for ephrin-B family proteins. Unlike other members of this family, the encoded protein does not contain a functional kinase domain. Activity of this protein can influence cell adhesion and migration. Expression of this gene is downregulated during tumor progression, suggesting that the protein may suppress tumor invasion and metastasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: T cell responses such as lymphokine secretion, proliferation, and the development of delayed-type skin hypersensitivity and experimental autoimmune encephalitis were compromised in homozygous null mutants. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930455H04Rik T A 3: 116,983,475 *59R probably null Het
Adam10 G T 9: 70,740,176 probably null Het
Adam2 A T 14: 66,037,576 N569K possibly damaging Het
Adam20 T C 8: 40,796,659 V602A probably benign Het
Adgrb3 T C 1: 25,094,294 Y1237C probably damaging Het
Ago3 T C 4: 126,371,545 T318A probably null Het
Aknad1 G A 3: 108,752,339 G223D possibly damaging Het
Camkv T C 9: 107,948,317 S478P possibly damaging Het
Ccl27a T A 4: 41,773,342 H39L probably damaging Het
Ccser2 C A 14: 36,879,086 S447I probably damaging Het
Clvs2 A G 10: 33,528,521 L233P probably damaging Het
Csn1s2b T A 5: 87,822,268 H124Q probably benign Het
Dnhd1 T C 7: 105,703,875 L2745P probably benign Het
Dync1i2 T A 2: 71,247,140 F219L probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Erc2 A C 14: 27,898,567 D50A possibly damaging Het
Fam149a T A 8: 45,381,174 D196V probably damaging Het
Fam46c T A 3: 100,472,957 N161I probably benign Het
Ficd T C 5: 113,738,712 V316A probably damaging Het
Gstm6 T A 3: 107,942,725 K18* probably null Het
Ighv1-62-1 A T 12: 115,386,892 W52R probably benign Het
Klhl18 C T 9: 110,428,911 C417Y probably damaging Het
Ly9 T A 1: 171,605,169 Y92F probably benign Het
Mettl18 C T 1: 163,997,181 T357I probably damaging Het
Myoz2 C A 3: 123,016,627 G100C probably damaging Het
Olfr1297 A G 2: 111,621,735 V113A probably damaging Het
Olfr517 A T 7: 108,868,573 F194I probably benign Het
Olfr871 T C 9: 20,212,502 I51T probably benign Het
Pars2 C T 4: 106,653,431 L128F probably damaging Het
Pcsk6 G T 7: 65,980,248 R374L probably damaging Het
Ptpn3 T C 4: 57,270,088 T25A probably benign Het
Rab11fip1 G A 8: 27,143,229 P1150S probably damaging Het
Rabep1 A G 11: 70,940,386 Q831R possibly damaging Het
Rad17 T C 13: 100,649,745 probably benign Het
Rxfp1 T A 3: 79,650,591 R527* probably null Het
Scnn1b C T 7: 121,902,877 P253S probably damaging Het
Skiv2l G A 17: 34,845,190 R507* probably null Het
Slc2a7 T C 4: 150,158,148 F231S probably damaging Het
Svil A G 18: 5,049,311 N196S probably benign Het
Urb1 T C 16: 90,779,083 S862G possibly damaging Het
Usp30 T C 5: 114,103,709 S87P probably damaging Het
Vmn1r177 T A 7: 23,865,812 H213L probably damaging Het
Vmn2r106 T A 17: 20,278,834 I272L possibly damaging Het
Vmn2r120 T A 17: 57,525,012 D259V probably benign Het
Other mutations in Ephb6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Ephb6 APN 6 41615911 unclassified probably benign
IGL01691:Ephb6 APN 6 41614515 missense probably benign 0.26
IGL02052:Ephb6 APN 6 41613322 missense probably benign
IGL02079:Ephb6 APN 6 41616014 missense possibly damaging 0.57
IGL03089:Ephb6 APN 6 41614174 missense probably damaging 1.00
P4748:Ephb6 UTSW 6 41617285 missense probably damaging 0.96
R0022:Ephb6 UTSW 6 41614569 missense probably damaging 0.98
R0022:Ephb6 UTSW 6 41614569 missense probably damaging 0.98
R0106:Ephb6 UTSW 6 41619594 unclassified probably benign
R0106:Ephb6 UTSW 6 41619594 unclassified probably benign
R0973:Ephb6 UTSW 6 41614104 missense probably damaging 0.98
R0973:Ephb6 UTSW 6 41614104 missense probably damaging 0.98
R0974:Ephb6 UTSW 6 41614104 missense probably damaging 0.98
R1465:Ephb6 UTSW 6 41616106 missense probably damaging 1.00
R1465:Ephb6 UTSW 6 41616106 missense probably damaging 1.00
R1610:Ephb6 UTSW 6 41614373 nonsense probably null
R1658:Ephb6 UTSW 6 41614245 missense probably damaging 1.00
R1687:Ephb6 UTSW 6 41617366 missense probably benign 0.08
R1733:Ephb6 UTSW 6 41619720 missense probably benign 0.10
R2191:Ephb6 UTSW 6 41616085 missense possibly damaging 0.82
R2439:Ephb6 UTSW 6 41618735 missense probably benign 0.31
R2915:Ephb6 UTSW 6 41614238 missense probably damaging 1.00
R3020:Ephb6 UTSW 6 41614521 missense probably damaging 1.00
R3499:Ephb6 UTSW 6 41616159 nonsense probably null
R4606:Ephb6 UTSW 6 41616574 missense probably benign 0.15
R4663:Ephb6 UTSW 6 41617865 missense probably damaging 1.00
R4668:Ephb6 UTSW 6 41614602 missense possibly damaging 0.91
R4762:Ephb6 UTSW 6 41618160 missense probably damaging 0.99
R4767:Ephb6 UTSW 6 41614185 missense possibly damaging 0.81
R4780:Ephb6 UTSW 6 41616139 missense probably damaging 1.00
R4846:Ephb6 UTSW 6 41616809 missense probably benign
R4851:Ephb6 UTSW 6 41618145 missense probably benign 0.00
R5016:Ephb6 UTSW 6 41618107 missense probably benign 0.01
R5122:Ephb6 UTSW 6 41613404 missense probably benign 0.00
R5313:Ephb6 UTSW 6 41616793 missense possibly damaging 0.68
R5615:Ephb6 UTSW 6 41619291 missense probably benign
R5623:Ephb6 UTSW 6 41616481 missense probably benign 0.20
R5686:Ephb6 UTSW 6 41619704 missense possibly damaging 0.57
R5840:Ephb6 UTSW 6 41615573 missense possibly damaging 0.94
R6147:Ephb6 UTSW 6 41616781 missense probably damaging 1.00
R6645:Ephb6 UTSW 6 41617272 missense probably benign 0.01
R7412:Ephb6 UTSW 6 41620239 missense probably damaging 1.00
R7442:Ephb6 UTSW 6 41618047 splice site probably null
R7759:Ephb6 UTSW 6 41614605 missense probably benign 0.00
R7857:Ephb6 UTSW 6 41613397 missense probably benign
R8425:Ephb6 UTSW 6 41618646 missense probably damaging 0.98
X0027:Ephb6 UTSW 6 41620080 makesense probably null
Predicted Primers PCR Primer
(F):5'- GGCATCAGAGGCATGTGAAC -3'
(R):5'- TGACACTTGCTTCTATCGGC -3'

Sequencing Primer
(F):5'- TGTGAACACAAAGCAAGCCTG -3'
(R):5'- GGCTTGCATCGTCCCCAAC -3'
Posted On2018-08-01