Incidental Mutation 'R6730:Scnn1b'
List |< first << previous [record 37 of 45] next >> last >|
ID530021
Institutional Source Beutler Lab
Gene Symbol Scnn1b
Ensembl Gene ENSMUSG00000030873
Gene Namesodium channel, nonvoltage-gated 1 beta
SynonymsENaC beta
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6730 (G1)
Quality Score211.009
Status Validated
Chromosome7
Chromosomal Location121865038-121918514 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 121902877 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 253 (P253S)
Ref Sequence ENSEMBL: ENSMUSP00000145900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033161] [ENSMUST00000205438] [ENSMUST00000205520] [ENSMUST00000206079]
Predicted Effect probably damaging
Transcript: ENSMUST00000033161
AA Change: P253S

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000033161
Gene: ENSMUSG00000030873
AA Change: P253S

DomainStartEndE-ValueType
Pfam:ASC 29 541 2.4e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205438
Predicted Effect probably damaging
Transcript: ENSMUST00000205520
AA Change: P253S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000206079
Meta Mutation Damage Score 0.1047 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nonvoltage-gated, amiloride-sensitive, sodium channels control fluid and electrolyte transport across epithelia in many organs. These channels are heteromeric complexes consisting of 3 subunits: alpha, beta, and gamma. This gene encodes the beta subunit, and mutations in this gene have been associated with pseudohypoaldosteronism type 1 (PHA1), and Liddle syndrome. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous mutation of this gene results in death shortly after birth, decreased serum sodium levels but higher urine sodium levels and increased serum potassium and chloride levels but lower potassium urine levels. Another homozygous mutation exhibits no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930455H04Rik T A 3: 116,983,475 *59R probably null Het
Adam10 G T 9: 70,740,176 probably null Het
Adam2 A T 14: 66,037,576 N569K possibly damaging Het
Adam20 T C 8: 40,796,659 V602A probably benign Het
Adgrb3 T C 1: 25,094,294 Y1237C probably damaging Het
Ago3 T C 4: 126,371,545 T318A probably null Het
Aknad1 G A 3: 108,752,339 G223D possibly damaging Het
Camkv T C 9: 107,948,317 S478P possibly damaging Het
Ccl27a T A 4: 41,773,342 H39L probably damaging Het
Ccser2 C A 14: 36,879,086 S447I probably damaging Het
Clvs2 A G 10: 33,528,521 L233P probably damaging Het
Csn1s2b T A 5: 87,822,268 H124Q probably benign Het
Dnhd1 T C 7: 105,703,875 L2745P probably benign Het
Dync1i2 T A 2: 71,247,140 F219L probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ephb6 C T 6: 41,617,374 Q613* probably null Het
Erc2 A C 14: 27,898,567 D50A possibly damaging Het
Fam149a T A 8: 45,381,174 D196V probably damaging Het
Fam46c T A 3: 100,472,957 N161I probably benign Het
Ficd T C 5: 113,738,712 V316A probably damaging Het
Gstm6 T A 3: 107,942,725 K18* probably null Het
Ighv1-62-1 A T 12: 115,386,892 W52R probably benign Het
Klhl18 C T 9: 110,428,911 C417Y probably damaging Het
Ly9 T A 1: 171,605,169 Y92F probably benign Het
Mettl18 C T 1: 163,997,181 T357I probably damaging Het
Myoz2 C A 3: 123,016,627 G100C probably damaging Het
Olfr1297 A G 2: 111,621,735 V113A probably damaging Het
Olfr517 A T 7: 108,868,573 F194I probably benign Het
Olfr871 T C 9: 20,212,502 I51T probably benign Het
Pars2 C T 4: 106,653,431 L128F probably damaging Het
Pcsk6 G T 7: 65,980,248 R374L probably damaging Het
Ptpn3 T C 4: 57,270,088 T25A probably benign Het
Rab11fip1 G A 8: 27,143,229 P1150S probably damaging Het
Rabep1 A G 11: 70,940,386 Q831R possibly damaging Het
Rad17 T C 13: 100,649,745 probably benign Het
Rxfp1 T A 3: 79,650,591 R527* probably null Het
Skiv2l G A 17: 34,845,190 R507* probably null Het
Slc2a7 T C 4: 150,158,148 F231S probably damaging Het
Svil A G 18: 5,049,311 N196S probably benign Het
Urb1 T C 16: 90,779,083 S862G possibly damaging Het
Usp30 T C 5: 114,103,709 S87P probably damaging Het
Vmn1r177 T A 7: 23,865,812 H213L probably damaging Het
Vmn2r106 T A 17: 20,278,834 I272L possibly damaging Het
Vmn2r120 T A 17: 57,525,012 D259V probably benign Het
Other mutations in Scnn1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Scnn1b APN 7 121918036 missense probably damaging 1.00
IGL01108:Scnn1b APN 7 121914332 splice site probably null
IGL02191:Scnn1b APN 7 121917513 missense probably damaging 1.00
IGL02197:Scnn1b APN 7 121902890 missense probably null 0.89
IGL02355:Scnn1b APN 7 121917547 missense probably damaging 1.00
IGL02362:Scnn1b APN 7 121917547 missense probably damaging 1.00
IGL02554:Scnn1b APN 7 121917523 missense probably damaging 1.00
IGL02834:Scnn1b APN 7 121912062 missense probably damaging 1.00
R0266:Scnn1b UTSW 7 121912475 missense probably damaging 1.00
R0494:Scnn1b UTSW 7 121899458 missense probably damaging 1.00
R0849:Scnn1b UTSW 7 121912475 missense probably damaging 1.00
R0872:Scnn1b UTSW 7 121914330 critical splice donor site probably null
R0899:Scnn1b UTSW 7 121917715 missense probably damaging 1.00
R1386:Scnn1b UTSW 7 121902488 missense possibly damaging 0.60
R1406:Scnn1b UTSW 7 121902544 critical splice donor site probably null
R1406:Scnn1b UTSW 7 121902544 critical splice donor site probably null
R1662:Scnn1b UTSW 7 121902328 missense probably benign 0.00
R1782:Scnn1b UTSW 7 121917961 missense probably benign
R1829:Scnn1b UTSW 7 121902845 missense probably benign 0.00
R1861:Scnn1b UTSW 7 121914261 missense probably damaging 1.00
R1928:Scnn1b UTSW 7 121910447 missense probably damaging 1.00
R4016:Scnn1b UTSW 7 121914332 splice site probably null
R4192:Scnn1b UTSW 7 121902739 missense possibly damaging 0.63
R4504:Scnn1b UTSW 7 121912475 missense probably damaging 1.00
R4745:Scnn1b UTSW 7 121902286 missense probably benign 0.03
R4888:Scnn1b UTSW 7 121902887 missense probably benign 0.06
R4941:Scnn1b UTSW 7 121912008 missense probably damaging 1.00
R5121:Scnn1b UTSW 7 121902887 missense probably benign 0.06
R6379:Scnn1b UTSW 7 121915328 missense probably benign 0.10
R6516:Scnn1b UTSW 7 121912112 missense probably damaging 1.00
R6650:Scnn1b UTSW 7 121902820 missense probably damaging 0.97
R7151:Scnn1b UTSW 7 121917886 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATTCCTTCCTGAGAAGCGC -3'
(R):5'- TGTCATGAGCTGTCTCGGAC -3'

Sequencing Primer
(F):5'- TCTCACAGTGCAGTGCCAATG -3'
(R):5'- TGTCTCGGACGTGCCTC -3'
Posted On2018-08-01