Incidental Mutation 'R6730:Adam20'
List |< first << previous [record 4 of 45] next >> last >|
ID530022
Institutional Source Beutler Lab
Gene Symbol Adam20
Ensembl Gene ENSMUSG00000046282
Gene Namea disintegrin and metallopeptidase domain 20
Synonyms4930529F22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6730 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location40793273-40797303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40796659 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 602 (V602A)
Ref Sequence ENSEMBL: ENSMUSP00000057794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056331]
Predicted Effect probably benign
Transcript: ENSMUST00000056331
AA Change: V602A

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000057794
Gene: ENSMUSG00000046282
AA Change: V602A

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 51 177 1.3e-19 PFAM
Pfam:Reprolysin_5 219 399 5.4e-16 PFAM
Pfam:Reprolysin_4 219 408 5.4e-11 PFAM
Pfam:Reprolysin 221 411 3.1e-45 PFAM
Pfam:Reprolysin_3 248 366 2.5e-13 PFAM
Pfam:Reprolysin_2 295 403 1e-14 PFAM
DISIN 429 504 4.29e-33 SMART
ACR 505 641 3.9e-74 SMART
transmembrane domain 703 722 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930455H04Rik T A 3: 116,983,475 *59R probably null Het
Adam10 G T 9: 70,740,176 probably null Het
Adam2 A T 14: 66,037,576 N569K possibly damaging Het
Adgrb3 T C 1: 25,094,294 Y1237C probably damaging Het
Ago3 T C 4: 126,371,545 T318A probably null Het
Aknad1 G A 3: 108,752,339 G223D possibly damaging Het
Camkv T C 9: 107,948,317 S478P possibly damaging Het
Ccl27a T A 4: 41,773,342 H39L probably damaging Het
Ccser2 C A 14: 36,879,086 S447I probably damaging Het
Clvs2 A G 10: 33,528,521 L233P probably damaging Het
Csn1s2b T A 5: 87,822,268 H124Q probably benign Het
Dnhd1 T C 7: 105,703,875 L2745P probably benign Het
Dync1i2 T A 2: 71,247,140 F219L probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ephb6 C T 6: 41,617,374 Q613* probably null Het
Erc2 A C 14: 27,898,567 D50A possibly damaging Het
Fam149a T A 8: 45,381,174 D196V probably damaging Het
Fam46c T A 3: 100,472,957 N161I probably benign Het
Ficd T C 5: 113,738,712 V316A probably damaging Het
Gstm6 T A 3: 107,942,725 K18* probably null Het
Ighv1-62-1 A T 12: 115,386,892 W52R probably benign Het
Klhl18 C T 9: 110,428,911 C417Y probably damaging Het
Ly9 T A 1: 171,605,169 Y92F probably benign Het
Mettl18 C T 1: 163,997,181 T357I probably damaging Het
Myoz2 C A 3: 123,016,627 G100C probably damaging Het
Olfr1297 A G 2: 111,621,735 V113A probably damaging Het
Olfr517 A T 7: 108,868,573 F194I probably benign Het
Olfr871 T C 9: 20,212,502 I51T probably benign Het
Pars2 C T 4: 106,653,431 L128F probably damaging Het
Pcsk6 G T 7: 65,980,248 R374L probably damaging Het
Ptpn3 T C 4: 57,270,088 T25A probably benign Het
Rab11fip1 G A 8: 27,143,229 P1150S probably damaging Het
Rabep1 A G 11: 70,940,386 Q831R possibly damaging Het
Rad17 T C 13: 100,649,745 probably benign Het
Rxfp1 T A 3: 79,650,591 R527* probably null Het
Scnn1b C T 7: 121,902,877 P253S probably damaging Het
Skiv2l G A 17: 34,845,190 R507* probably null Het
Slc2a7 T C 4: 150,158,148 F231S probably damaging Het
Svil A G 18: 5,049,311 N196S probably benign Het
Urb1 T C 16: 90,779,083 S862G possibly damaging Het
Usp30 T C 5: 114,103,709 S87P probably damaging Het
Vmn1r177 T A 7: 23,865,812 H213L probably damaging Het
Vmn2r106 T A 17: 20,278,834 I272L possibly damaging Het
Vmn2r120 T A 17: 57,525,012 D259V probably benign Het
Other mutations in Adam20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Adam20 APN 8 40796047 missense probably benign 0.00
IGL01357:Adam20 APN 8 40796560 missense probably benign 0.09
IGL01877:Adam20 APN 8 40795945 missense probably benign 0.00
IGL02295:Adam20 APN 8 40796836 missense probably damaging 1.00
IGL02683:Adam20 APN 8 40795584 missense probably damaging 0.98
IGL03090:Adam20 APN 8 40794928 missense probably benign 0.00
BB007:Adam20 UTSW 8 40797070 missense probably benign 0.00
BB017:Adam20 UTSW 8 40797070 missense probably benign 0.00
PIT4151001:Adam20 UTSW 8 40795044 missense possibly damaging 0.58
PIT4696001:Adam20 UTSW 8 40794948 missense probably benign 0.20
R0607:Adam20 UTSW 8 40795480 missense probably benign 0.02
R0885:Adam20 UTSW 8 40796558 missense probably benign 0.02
R1018:Adam20 UTSW 8 40796109 nonsense probably null
R1147:Adam20 UTSW 8 40795618 missense possibly damaging 0.82
R1147:Adam20 UTSW 8 40795618 missense possibly damaging 0.82
R1421:Adam20 UTSW 8 40796747 missense possibly damaging 0.48
R1739:Adam20 UTSW 8 40796558 missense probably benign 0.02
R1778:Adam20 UTSW 8 40796661 missense possibly damaging 0.92
R1844:Adam20 UTSW 8 40796043 missense probably benign
R3814:Adam20 UTSW 8 40795675 missense probably damaging 1.00
R3877:Adam20 UTSW 8 40796634 missense possibly damaging 0.75
R4193:Adam20 UTSW 8 40795315 missense probably damaging 0.99
R4357:Adam20 UTSW 8 40795047 missense possibly damaging 0.61
R4846:Adam20 UTSW 8 40795011 missense probably benign 0.10
R5452:Adam20 UTSW 8 40795764 missense probably damaging 0.96
R6559:Adam20 UTSW 8 40796292 missense probably benign 0.03
R6708:Adam20 UTSW 8 40796494 missense probably damaging 1.00
R7194:Adam20 UTSW 8 40796412 missense probably benign 0.45
R7323:Adam20 UTSW 8 40795384 missense probably benign 0.45
R7917:Adam20 UTSW 8 40796371 missense probably damaging 1.00
R7930:Adam20 UTSW 8 40797070 missense probably benign 0.00
R7954:Adam20 UTSW 8 40796544 missense probably damaging 1.00
R7964:Adam20 UTSW 8 40796907 missense probably damaging 0.97
R8006:Adam20 UTSW 8 40795907 missense probably benign 0.02
R8125:Adam20 UTSW 8 40794936 missense probably benign 0.01
R8134:Adam20 UTSW 8 40796064 missense probably benign 0.02
R8435:Adam20 UTSW 8 40795035 missense probably damaging 1.00
X0062:Adam20 UTSW 8 40797024 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CAGTTGCTACAGAGAACTCAAC -3'
(R):5'- CCACTTTCCAGGCAATGTGG -3'

Sequencing Primer
(F):5'- TGCTACAGAGAACTCAACACCCAAG -3'
(R):5'- GGCAGTGATGTAAATTGTTGCACAC -3'
Posted On2018-08-01