Incidental Mutation 'R6730:Fam149a'
List |< first << previous [record 18 of 45] next >> last >|
ID530023
Institutional Source Beutler Lab
Gene Symbol Fam149a
Ensembl Gene ENSMUSG00000070044
Gene Namefamily with sequence similarity 149, member A
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6730 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location45336717-45382291 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45381174 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 196 (D196V)
Ref Sequence ENSEMBL: ENSMUSP00000091245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093526]
Predicted Effect probably damaging
Transcript: ENSMUST00000093526
AA Change: D196V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091245
Gene: ENSMUSG00000070044
AA Change: D196V

DomainStartEndE-ValueType
low complexity region 48 65 N/A INTRINSIC
low complexity region 96 111 N/A INTRINSIC
low complexity region 239 250 N/A INTRINSIC
low complexity region 262 274 N/A INTRINSIC
Pfam:DUF3719 305 370 4.3e-30 PFAM
Meta Mutation Damage Score 0.1375 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930455H04Rik T A 3: 116,983,475 *59R probably null Het
Adam10 G T 9: 70,740,176 probably null Het
Adam2 A T 14: 66,037,576 N569K possibly damaging Het
Adam20 T C 8: 40,796,659 V602A probably benign Het
Adgrb3 T C 1: 25,094,294 Y1237C probably damaging Het
Ago3 T C 4: 126,371,545 T318A probably null Het
Aknad1 G A 3: 108,752,339 G223D possibly damaging Het
Camkv T C 9: 107,948,317 S478P possibly damaging Het
Ccl27a T A 4: 41,773,342 H39L probably damaging Het
Ccser2 C A 14: 36,879,086 S447I probably damaging Het
Clvs2 A G 10: 33,528,521 L233P probably damaging Het
Csn1s2b T A 5: 87,822,268 H124Q probably benign Het
Dnhd1 T C 7: 105,703,875 L2745P probably benign Het
Dync1i2 T A 2: 71,247,140 F219L probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ephb6 C T 6: 41,617,374 Q613* probably null Het
Erc2 A C 14: 27,898,567 D50A possibly damaging Het
Fam46c T A 3: 100,472,957 N161I probably benign Het
Ficd T C 5: 113,738,712 V316A probably damaging Het
Gstm6 T A 3: 107,942,725 K18* probably null Het
Ighv1-62-1 A T 12: 115,386,892 W52R probably benign Het
Klhl18 C T 9: 110,428,911 C417Y probably damaging Het
Ly9 T A 1: 171,605,169 Y92F probably benign Het
Mettl18 C T 1: 163,997,181 T357I probably damaging Het
Myoz2 C A 3: 123,016,627 G100C probably damaging Het
Olfr1297 A G 2: 111,621,735 V113A probably damaging Het
Olfr517 A T 7: 108,868,573 F194I probably benign Het
Olfr871 T C 9: 20,212,502 I51T probably benign Het
Pars2 C T 4: 106,653,431 L128F probably damaging Het
Pcsk6 G T 7: 65,980,248 R374L probably damaging Het
Ptpn3 T C 4: 57,270,088 T25A probably benign Het
Rab11fip1 G A 8: 27,143,229 P1150S probably damaging Het
Rabep1 A G 11: 70,940,386 Q831R possibly damaging Het
Rad17 T C 13: 100,649,745 probably benign Het
Rxfp1 T A 3: 79,650,591 R527* probably null Het
Scnn1b C T 7: 121,902,877 P253S probably damaging Het
Skiv2l G A 17: 34,845,190 R507* probably null Het
Slc2a7 T C 4: 150,158,148 F231S probably damaging Het
Svil A G 18: 5,049,311 N196S probably benign Het
Urb1 T C 16: 90,779,083 S862G possibly damaging Het
Usp30 T C 5: 114,103,709 S87P probably damaging Het
Vmn1r177 T A 7: 23,865,812 H213L probably damaging Het
Vmn2r106 T A 17: 20,278,834 I272L possibly damaging Het
Vmn2r120 T A 17: 57,525,012 D259V probably benign Het
Other mutations in Fam149a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Fam149a APN 8 45339343 missense probably damaging 1.00
IGL00229:Fam149a APN 8 45351786 missense probably damaging 0.98
IGL01089:Fam149a APN 8 45348527 missense possibly damaging 0.95
IGL01578:Fam149a APN 8 45350442 missense probably damaging 1.00
IGL03095:Fam149a APN 8 45341228 missense probably damaging 1.00
IGL03112:Fam149a APN 8 45348543 missense possibly damaging 0.78
guangxi UTSW 8 45381741 missense probably damaging 1.00
PIT1430001:Fam149a UTSW 8 45351706 missense probably benign 0.00
R0111:Fam149a UTSW 8 45341146 splice site probably benign
R0113:Fam149a UTSW 8 45341024 missense probably damaging 1.00
R0452:Fam149a UTSW 8 45355649 missense probably damaging 1.00
R0604:Fam149a UTSW 8 45345008 missense probably damaging 1.00
R1441:Fam149a UTSW 8 45355647 missense probably damaging 1.00
R1672:Fam149a UTSW 8 45339374 critical splice acceptor site probably null
R1861:Fam149a UTSW 8 45339362 nonsense probably null
R1981:Fam149a UTSW 8 45381741 missense probably damaging 1.00
R2173:Fam149a UTSW 8 45353954 missense probably damaging 1.00
R2211:Fam149a UTSW 8 45341009 missense probably damaging 0.99
R3807:Fam149a UTSW 8 45381610 missense possibly damaging 0.91
R4176:Fam149a UTSW 8 45341284 missense probably benign 0.41
R4913:Fam149a UTSW 8 45353883 missense probably damaging 1.00
R5158:Fam149a UTSW 8 45350435 missense possibly damaging 0.51
R5172:Fam149a UTSW 8 45344653 missense probably damaging 0.99
R5436:Fam149a UTSW 8 45348471 missense probably benign 0.21
R6060:Fam149a UTSW 8 45358762 intron probably benign
R6426:Fam149a UTSW 8 45381574 missense probably benign
R6590:Fam149a UTSW 8 45349034 missense probably damaging 1.00
R6596:Fam149a UTSW 8 45381630 missense probably benign 0.25
R6690:Fam149a UTSW 8 45349034 missense probably damaging 1.00
R6734:Fam149a UTSW 8 45381441 missense probably benign
R6916:Fam149a UTSW 8 45350406 missense probably damaging 1.00
R7088:Fam149a UTSW 8 45350545 missense probably benign 0.08
R7219:Fam149a UTSW 8 45350563 missense possibly damaging 0.94
R7352:Fam149a UTSW 8 45340997 missense probably damaging 0.98
R7454:Fam149a UTSW 8 45348546 missense probably benign 0.29
R7591:Fam149a UTSW 8 45350435 missense possibly damaging 0.89
R7788:Fam149a UTSW 8 45381517 missense probably damaging 1.00
R7846:Fam149a UTSW 8 45358641 missense
R7915:Fam149a UTSW 8 45341243 missense probably benign
R8036:Fam149a UTSW 8 45349011 missense probably benign 0.00
R8181:Fam149a UTSW 8 45381718 missense possibly damaging 0.92
R8239:Fam149a UTSW 8 45350453 missense possibly damaging 0.48
R8246:Fam149a UTSW 8 45381618 missense probably benign 0.00
Z1176:Fam149a UTSW 8 45342458 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGACCTAGCACACAGTCTGTCC -3'
(R):5'- AGTGACTTTACCCAGCCCAG -3'

Sequencing Primer
(F):5'- TTGATCAACAAGAAGTTTACTGTGAG -3'
(R):5'- AGCCCAGGGGTTGACTG -3'
Posted On2018-08-01