Incidental Mutation 'R6730:Adam10'
ID530025
Institutional Source Beutler Lab
Gene Symbol Adam10
Ensembl Gene ENSMUSG00000054693
Gene Namea disintegrin and metallopeptidase domain 10
Synonymskuzbanian, 1700031C13Rik, kuz
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6730 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location70678997-70780229 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 70740176 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067880] [ENSMUST00000140205] [ENSMUST00000144537]
Predicted Effect probably null
Transcript: ENSMUST00000067880
SMART Domains Protein: ENSMUSP00000063839
Gene: ENSMUSG00000054693

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Pep_M12B_propep 27 156 7.5e-15 PFAM
Pfam:Reprolysin_5 219 434 1e-33 PFAM
Pfam:Reprolysin_4 219 453 2.1e-29 PFAM
Pfam:Reprolysin 221 457 6.1e-8 PFAM
Pfam:Reprolysin_2 240 447 6.5e-39 PFAM
Pfam:Reprolysin_3 244 395 4.6e-27 PFAM
DISIN 467 551 5.99e-23 SMART
transmembrane domain 675 697 N/A INTRINSIC
low complexity region 709 739 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140205
SMART Domains Protein: ENSMUSP00000117162
Gene: ENSMUSG00000054693

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Pep_M12B_propep 26 156 5.8e-18 PFAM
Pfam:Reprolysin_5 219 434 2.6e-34 PFAM
Pfam:Reprolysin_4 219 453 4e-30 PFAM
Pfam:Reprolysin 221 457 4.4e-10 PFAM
Pfam:Reprolysin_2 240 447 5.1e-36 PFAM
Pfam:Reprolysin_3 244 395 1.7e-24 PFAM
DISIN 467 513 1.48e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000144537
SMART Domains Protein: ENSMUSP00000116867
Gene: ENSMUSG00000054693

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Reprolysin_5 76 145 5.8e-9 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature enzyme that is involved in the proteolytic release of membrane-bound proteins in a process called ectodomain shedding. Mice lacking the encoded protein die in utero with multiple defects of the developing central nervous system, somites, and cardiovascular system. [provided by RefSeq, May 2016]
PHENOTYPE: Targeted inactivation of this gene leads to embryonic lethality at E9.5. Embryos homozygous for a knock-out allele display decreased size and multiple abnormalities related to Notch signaling, including defects of the developing central nervous system, somites, and cardiovascular system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930455H04Rik T A 3: 116,983,475 *59R probably null Het
Adam2 A T 14: 66,037,576 N569K possibly damaging Het
Adam20 T C 8: 40,796,659 V602A probably benign Het
Adgrb3 T C 1: 25,094,294 Y1237C probably damaging Het
Ago3 T C 4: 126,371,545 T318A probably null Het
Aknad1 G A 3: 108,752,339 G223D possibly damaging Het
Camkv T C 9: 107,948,317 S478P possibly damaging Het
Ccl27a T A 4: 41,773,342 H39L probably damaging Het
Ccser2 C A 14: 36,879,086 S447I probably damaging Het
Clvs2 A G 10: 33,528,521 L233P probably damaging Het
Csn1s2b T A 5: 87,822,268 H124Q probably benign Het
Dnhd1 T C 7: 105,703,875 L2745P probably benign Het
Dync1i2 T A 2: 71,247,140 F219L probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ephb6 C T 6: 41,617,374 Q613* probably null Het
Erc2 A C 14: 27,898,567 D50A possibly damaging Het
Fam149a T A 8: 45,381,174 D196V probably damaging Het
Fam46c T A 3: 100,472,957 N161I probably benign Het
Ficd T C 5: 113,738,712 V316A probably damaging Het
Gstm6 T A 3: 107,942,725 K18* probably null Het
Ighv1-62-1 A T 12: 115,386,892 W52R probably benign Het
Klhl18 C T 9: 110,428,911 C417Y probably damaging Het
Ly9 T A 1: 171,605,169 Y92F probably benign Het
Mettl18 C T 1: 163,997,181 T357I probably damaging Het
Myoz2 C A 3: 123,016,627 G100C probably damaging Het
Olfr1297 A G 2: 111,621,735 V113A probably damaging Het
Olfr517 A T 7: 108,868,573 F194I probably benign Het
Olfr871 T C 9: 20,212,502 I51T probably benign Het
Pars2 C T 4: 106,653,431 L128F probably damaging Het
Pcsk6 G T 7: 65,980,248 R374L probably damaging Het
Ptpn3 T C 4: 57,270,088 T25A probably benign Het
Rab11fip1 G A 8: 27,143,229 P1150S probably damaging Het
Rabep1 A G 11: 70,940,386 Q831R possibly damaging Het
Rad17 T C 13: 100,649,745 probably benign Het
Rxfp1 T A 3: 79,650,591 R527* probably null Het
Scnn1b C T 7: 121,902,877 P253S probably damaging Het
Skiv2l G A 17: 34,845,190 R507* probably null Het
Slc2a7 T C 4: 150,158,148 F231S probably damaging Het
Svil A G 18: 5,049,311 N196S probably benign Het
Urb1 T C 16: 90,779,083 S862G possibly damaging Het
Usp30 T C 5: 114,103,709 S87P probably damaging Het
Vmn1r177 T A 7: 23,865,812 H213L probably damaging Het
Vmn2r106 T A 17: 20,278,834 I272L possibly damaging Het
Vmn2r120 T A 17: 57,525,012 D259V probably benign Het
Other mutations in Adam10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Adam10 APN 9 70718746 missense possibly damaging 0.92
IGL00582:Adam10 APN 9 70766895 missense possibly damaging 0.54
IGL02021:Adam10 APN 9 70743909 missense possibly damaging 0.60
IGL02149:Adam10 APN 9 70703431 missense probably damaging 1.00
IGL03310:Adam10 APN 9 70778089 missense probably damaging 1.00
PIT4382001:Adam10 UTSW 9 70766081 missense probably damaging 1.00
R0110:Adam10 UTSW 9 70748248 missense probably damaging 1.00
R0469:Adam10 UTSW 9 70748248 missense probably damaging 1.00
R0510:Adam10 UTSW 9 70748248 missense probably damaging 1.00
R0555:Adam10 UTSW 9 70754234 missense probably damaging 1.00
R0671:Adam10 UTSW 9 70765941 splice site probably benign
R0735:Adam10 UTSW 9 70748251 missense possibly damaging 0.81
R0785:Adam10 UTSW 9 70767888 missense possibly damaging 0.86
R0881:Adam10 UTSW 9 70746237 missense probably damaging 1.00
R1019:Adam10 UTSW 9 70761640 missense probably benign 0.00
R1169:Adam10 UTSW 9 70746292 missense probably damaging 0.97
R1779:Adam10 UTSW 9 70776369 splice site probably benign
R2048:Adam10 UTSW 9 70740075 missense possibly damaging 0.89
R2911:Adam10 UTSW 9 70718723 missense probably damaging 0.99
R3890:Adam10 UTSW 9 70768854 missense probably benign 0.00
R4608:Adam10 UTSW 9 70743891 missense probably damaging 0.99
R4609:Adam10 UTSW 9 70740143 missense probably damaging 1.00
R4689:Adam10 UTSW 9 70765954 missense possibly damaging 0.51
R5135:Adam10 UTSW 9 70766074 missense probably damaging 1.00
R5496:Adam10 UTSW 9 70722739 missense probably damaging 1.00
R5499:Adam10 UTSW 9 70740117 missense probably benign 0.16
R6825:Adam10 UTSW 9 70761602 missense probably damaging 1.00
R6987:Adam10 UTSW 9 70722696 missense probably benign
R7616:Adam10 UTSW 9 70722711 missense possibly damaging 0.81
R7829:Adam10 UTSW 9 70766927 nonsense probably null
R7908:Adam10 UTSW 9 70761764 missense possibly damaging 0.83
R8445:Adam10 UTSW 9 70766921 missense probably benign 0.00
R8447:Adam10 UTSW 9 70748118 missense probably damaging 0.97
X0020:Adam10 UTSW 9 70740143 missense probably damaging 1.00
X0064:Adam10 UTSW 9 70765952 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTTCAGTAAACACTTACGGCCTTC -3'
(R):5'- AGCCACCGCTTTACTACTGC -3'

Sequencing Primer
(F):5'- ATTGGATGGATCCCCTGGAAC -3'
(R):5'- AGTCGAAACCAGGTCTTCTG -3'
Posted On2018-08-01