Incidental Mutation 'R6730:Camkv'
ID530026
Institutional Source Beutler Lab
Gene Symbol Camkv
Ensembl Gene ENSMUSG00000032936
Gene NameCaM kinase-like vesicle-associated
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6730 (G1)
Quality Score121.008
Status Validated
Chromosome9
Chromosomal Location107935674-107949691 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107948317 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 478 (S478P)
Ref Sequence ENSEMBL: ENSMUSP00000141444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035700] [ENSMUST00000049348] [ENSMUST00000193533] [ENSMUST00000194206] [ENSMUST00000194271] [ENSMUST00000195219]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035700
AA Change: S506P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000040430
Gene: ENSMUSG00000032936
AA Change: S506P

DomainStartEndE-ValueType
S_TKc 24 286 4.21e-81 SMART
low complexity region 332 385 N/A INTRINSIC
internal_repeat_1 392 425 3.43e-15 PROSPERO
internal_repeat_1 416 449 3.43e-15 PROSPERO
low complexity region 461 478 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000049348
SMART Domains Protein: ENSMUSP00000040001
Gene: ENSMUSG00000032586

DomainStartEndE-ValueType
RING 7 49 6.68e-6 SMART
coiled coil region 70 278 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192567
Predicted Effect probably benign
Transcript: ENSMUST00000193533
Predicted Effect possibly damaging
Transcript: ENSMUST00000194206
AA Change: S478P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000141444
Gene: ENSMUSG00000032936
AA Change: S478P

DomainStartEndE-ValueType
STYKc 24 258 2.3e-8 SMART
low complexity region 304 357 N/A INTRINSIC
internal_repeat_1 364 397 2.93e-15 PROSPERO
internal_repeat_1 388 421 2.93e-15 PROSPERO
low complexity region 433 450 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194271
SMART Domains Protein: ENSMUSP00000141689
Gene: ENSMUSG00000032586

DomainStartEndE-ValueType
RING 7 49 3.2e-8 SMART
coiled coil region 54 143 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194538
Predicted Effect probably benign
Transcript: ENSMUST00000195219
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930455H04Rik T A 3: 116,983,475 *59R probably null Het
Adam10 G T 9: 70,740,176 probably null Het
Adam2 A T 14: 66,037,576 N569K possibly damaging Het
Adam20 T C 8: 40,796,659 V602A probably benign Het
Adgrb3 T C 1: 25,094,294 Y1237C probably damaging Het
Ago3 T C 4: 126,371,545 T318A probably null Het
Aknad1 G A 3: 108,752,339 G223D possibly damaging Het
Ccl27a T A 4: 41,773,342 H39L probably damaging Het
Ccser2 C A 14: 36,879,086 S447I probably damaging Het
Clvs2 A G 10: 33,528,521 L233P probably damaging Het
Csn1s2b T A 5: 87,822,268 H124Q probably benign Het
Dnhd1 T C 7: 105,703,875 L2745P probably benign Het
Dync1i2 T A 2: 71,247,140 F219L probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ephb6 C T 6: 41,617,374 Q613* probably null Het
Erc2 A C 14: 27,898,567 D50A possibly damaging Het
Fam149a T A 8: 45,381,174 D196V probably damaging Het
Fam46c T A 3: 100,472,957 N161I probably benign Het
Ficd T C 5: 113,738,712 V316A probably damaging Het
Gstm6 T A 3: 107,942,725 K18* probably null Het
Ighv1-62-1 A T 12: 115,386,892 W52R probably benign Het
Klhl18 C T 9: 110,428,911 C417Y probably damaging Het
Ly9 T A 1: 171,605,169 Y92F probably benign Het
Mettl18 C T 1: 163,997,181 T357I probably damaging Het
Myoz2 C A 3: 123,016,627 G100C probably damaging Het
Olfr1297 A G 2: 111,621,735 V113A probably damaging Het
Olfr517 A T 7: 108,868,573 F194I probably benign Het
Olfr871 T C 9: 20,212,502 I51T probably benign Het
Pars2 C T 4: 106,653,431 L128F probably damaging Het
Pcsk6 G T 7: 65,980,248 R374L probably damaging Het
Ptpn3 T C 4: 57,270,088 T25A probably benign Het
Rab11fip1 G A 8: 27,143,229 P1150S probably damaging Het
Rabep1 A G 11: 70,940,386 Q831R possibly damaging Het
Rad17 T C 13: 100,649,745 probably benign Het
Rxfp1 T A 3: 79,650,591 R527* probably null Het
Scnn1b C T 7: 121,902,877 P253S probably damaging Het
Skiv2l G A 17: 34,845,190 R507* probably null Het
Slc2a7 T C 4: 150,158,148 F231S probably damaging Het
Svil A G 18: 5,049,311 N196S probably benign Het
Urb1 T C 16: 90,779,083 S862G possibly damaging Het
Usp30 T C 5: 114,103,709 S87P probably damaging Het
Vmn1r177 T A 7: 23,865,812 H213L probably damaging Het
Vmn2r106 T A 17: 20,278,834 I272L possibly damaging Het
Vmn2r120 T A 17: 57,525,012 D259V probably benign Het
Other mutations in Camkv
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0288:Camkv UTSW 9 107946356 missense probably damaging 1.00
R0834:Camkv UTSW 9 107945846 missense probably damaging 1.00
R1919:Camkv UTSW 9 107947088 missense possibly damaging 0.89
R1996:Camkv UTSW 9 107947121 missense probably damaging 1.00
R2165:Camkv UTSW 9 107945600 missense possibly damaging 0.48
R3943:Camkv UTSW 9 107947983 missense possibly damaging 0.70
R4006:Camkv UTSW 9 107946641 missense probably damaging 1.00
R4357:Camkv UTSW 9 107947946 missense probably benign 0.27
R4406:Camkv UTSW 9 107946219 critical splice donor site probably null
R4601:Camkv UTSW 9 107946096 missense probably damaging 0.99
R5078:Camkv UTSW 9 107945373 missense probably damaging 0.99
R5175:Camkv UTSW 9 107947382 missense probably damaging 1.00
R5373:Camkv UTSW 9 107946889 missense probably benign 0.05
R5379:Camkv UTSW 9 107945346 missense probably damaging 0.99
R5480:Camkv UTSW 9 107946875 missense probably damaging 1.00
R5484:Camkv UTSW 9 107946146 missense probably damaging 1.00
R6335:Camkv UTSW 9 107946695 critical splice donor site probably null
R8430:Camkv UTSW 9 107947769 missense probably damaging 0.99
RF010:Camkv UTSW 9 107947860 unclassified probably benign
RF039:Camkv UTSW 9 107947860 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGACAGAAGCGCTACACCAG -3'
(R):5'- CACAGGAGACAAGACTGCTCTC -3'

Sequencing Primer
(F):5'- CAGCTACTGATGGCAGAGC -3'
(R):5'- GGAGACAAGACTGCTCTCCCATG -3'
Posted On2018-08-01