Incidental Mutation 'R6730:Klhl18'
ID530027
Institutional Source Beutler Lab
Gene Symbol Klhl18
Ensembl Gene ENSMUSG00000054792
Gene Namekelch-like 18
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6730 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location110425926-110476694 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 110428911 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 417 (C417Y)
Ref Sequence ENSEMBL: ENSMUSP00000143384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068025] [ENSMUST00000198164] [ENSMUST00000198400]
Predicted Effect probably damaging
Transcript: ENSMUST00000068025
AA Change: C482Y

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000069674
Gene: ENSMUSG00000054792
AA Change: C482Y

DomainStartEndE-ValueType
BTB 38 135 1.32e-29 SMART
BACK 140 242 1.67e-39 SMART
Kelch 289 336 1.78e-14 SMART
Kelch 337 383 2.64e-17 SMART
Kelch 384 430 2.18e-18 SMART
Kelch 431 477 9.27e-13 SMART
Kelch 478 524 3.34e-5 SMART
Kelch 525 571 1.22e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197336
Predicted Effect probably damaging
Transcript: ENSMUST00000198164
AA Change: C487Y

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143634
Gene: ENSMUSG00000054792
AA Change: C487Y

DomainStartEndE-ValueType
BTB 38 135 1.32e-29 SMART
BACK 140 242 1.67e-39 SMART
Kelch 289 341 8.52e-12 SMART
Kelch 342 388 2.64e-17 SMART
Kelch 389 435 2.18e-18 SMART
Kelch 436 482 9.27e-13 SMART
Kelch 483 529 3.34e-5 SMART
Kelch 530 576 1.22e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000198400
AA Change: C417Y

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143384
Gene: ENSMUSG00000054792
AA Change: C417Y

DomainStartEndE-ValueType
Pfam:BTB 1 70 2.1e-15 PFAM
BACK 75 177 1.67e-39 SMART
Kelch 224 271 1.78e-14 SMART
Kelch 272 318 2.64e-17 SMART
Kelch 319 365 2.18e-18 SMART
Kelch 366 412 9.27e-13 SMART
Kelch 413 459 3.34e-5 SMART
Kelch 460 506 1.22e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199700
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930455H04Rik T A 3: 116,983,475 *59R probably null Het
Adam10 G T 9: 70,740,176 probably null Het
Adam2 A T 14: 66,037,576 N569K possibly damaging Het
Adam20 T C 8: 40,796,659 V602A probably benign Het
Adgrb3 T C 1: 25,094,294 Y1237C probably damaging Het
Ago3 T C 4: 126,371,545 T318A probably null Het
Aknad1 G A 3: 108,752,339 G223D possibly damaging Het
Camkv T C 9: 107,948,317 S478P possibly damaging Het
Ccl27a T A 4: 41,773,342 H39L probably damaging Het
Ccser2 C A 14: 36,879,086 S447I probably damaging Het
Clvs2 A G 10: 33,528,521 L233P probably damaging Het
Csn1s2b T A 5: 87,822,268 H124Q probably benign Het
Dnhd1 T C 7: 105,703,875 L2745P probably benign Het
Dync1i2 T A 2: 71,247,140 F219L probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ephb6 C T 6: 41,617,374 Q613* probably null Het
Erc2 A C 14: 27,898,567 D50A possibly damaging Het
Fam149a T A 8: 45,381,174 D196V probably damaging Het
Fam46c T A 3: 100,472,957 N161I probably benign Het
Ficd T C 5: 113,738,712 V316A probably damaging Het
Gstm6 T A 3: 107,942,725 K18* probably null Het
Ighv1-62-1 A T 12: 115,386,892 W52R probably benign Het
Ly9 T A 1: 171,605,169 Y92F probably benign Het
Mettl18 C T 1: 163,997,181 T357I probably damaging Het
Myoz2 C A 3: 123,016,627 G100C probably damaging Het
Olfr1297 A G 2: 111,621,735 V113A probably damaging Het
Olfr517 A T 7: 108,868,573 F194I probably benign Het
Olfr871 T C 9: 20,212,502 I51T probably benign Het
Pars2 C T 4: 106,653,431 L128F probably damaging Het
Pcsk6 G T 7: 65,980,248 R374L probably damaging Het
Ptpn3 T C 4: 57,270,088 T25A probably benign Het
Rab11fip1 G A 8: 27,143,229 P1150S probably damaging Het
Rabep1 A G 11: 70,940,386 Q831R possibly damaging Het
Rad17 T C 13: 100,649,745 probably benign Het
Rxfp1 T A 3: 79,650,591 R527* probably null Het
Scnn1b C T 7: 121,902,877 P253S probably damaging Het
Skiv2l G A 17: 34,845,190 R507* probably null Het
Slc2a7 T C 4: 150,158,148 F231S probably damaging Het
Svil A G 18: 5,049,311 N196S probably benign Het
Urb1 T C 16: 90,779,083 S862G possibly damaging Het
Usp30 T C 5: 114,103,709 S87P probably damaging Het
Vmn1r177 T A 7: 23,865,812 H213L probably damaging Het
Vmn2r106 T A 17: 20,278,834 I272L possibly damaging Het
Vmn2r120 T A 17: 57,525,012 D259V probably benign Het
Other mutations in Klhl18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Klhl18 APN 9 110428686 missense probably damaging 1.00
IGL01338:Klhl18 APN 9 110455433 missense probably damaging 1.00
IGL01455:Klhl18 APN 9 110432443 missense probably damaging 1.00
IGL01954:Klhl18 APN 9 110428866 missense probably damaging 1.00
IGL01960:Klhl18 APN 9 110450746 missense probably benign 0.25
IGL02195:Klhl18 APN 9 110438902 missense possibly damaging 0.92
IGL02430:Klhl18 APN 9 110437401 missense probably benign 0.25
IGL02629:Klhl18 APN 9 110429938 splice site probably benign
Mixie UTSW 9 110436062 missense probably benign 0.00
R0389:Klhl18 UTSW 9 110428681 missense probably benign 0.00
R1538:Klhl18 UTSW 9 110446747 missense probably damaging 1.00
R1777:Klhl18 UTSW 9 110437401 missense probably benign 0.25
R1966:Klhl18 UTSW 9 110476590 missense probably benign 0.14
R2099:Klhl18 UTSW 9 110455418 missense probably damaging 1.00
R3699:Klhl18 UTSW 9 110436066 missense probably benign 0.06
R3911:Klhl18 UTSW 9 110436083 missense probably damaging 1.00
R3950:Klhl18 UTSW 9 110428902 missense probably damaging 1.00
R4197:Klhl18 UTSW 9 110429944 critical splice donor site probably null
R4500:Klhl18 UTSW 9 110429966 missense probably damaging 1.00
R4936:Klhl18 UTSW 9 110428961 missense possibly damaging 0.88
R5296:Klhl18 UTSW 9 110436127 missense possibly damaging 0.64
R5298:Klhl18 UTSW 9 110436127 missense possibly damaging 0.64
R5301:Klhl18 UTSW 9 110436127 missense possibly damaging 0.64
R5407:Klhl18 UTSW 9 110436127 missense possibly damaging 0.64
R5433:Klhl18 UTSW 9 110436127 missense possibly damaging 0.64
R5641:Klhl18 UTSW 9 110446828 missense probably damaging 1.00
R6084:Klhl18 UTSW 9 110428727 missense possibly damaging 0.52
R6279:Klhl18 UTSW 9 110436062 missense probably benign 0.00
R6300:Klhl18 UTSW 9 110436062 missense probably benign 0.00
R6425:Klhl18 UTSW 9 110446681 missense possibly damaging 0.85
R6465:Klhl18 UTSW 9 110428920 missense probably benign 0.21
R6521:Klhl18 UTSW 9 110428635 missense possibly damaging 0.92
R6587:Klhl18 UTSW 9 110455426 missense probably damaging 1.00
R7110:Klhl18 UTSW 9 110450765 missense probably damaging 0.99
R7492:Klhl18 UTSW 9 110428775 nonsense probably null
R7580:Klhl18 UTSW 9 110436050 missense probably benign 0.00
R7598:Klhl18 UTSW 9 110446810 nonsense probably null
R7789:Klhl18 UTSW 9 110439008 missense unknown
R7988:Klhl18 UTSW 9 110476509 missense possibly damaging 0.87
R8050:Klhl18 UTSW 9 110428761 missense probably damaging 1.00
Z1176:Klhl18 UTSW 9 110437347 missense probably null 0.99
Predicted Primers PCR Primer
(F):5'- GCTTAGGTTTGACTGTCCATCG -3'
(R):5'- GGGTACACACTAACTGAACTCC -3'

Sequencing Primer
(F):5'- AGGTTTGACTGTCCATCGTAACC -3'
(R):5'- CACCGTGTAGGCTTCTGTGC -3'
Posted On2018-08-01