Incidental Mutation 'R6730:Rad17'
ID530031
Institutional Source Beutler Lab
Gene Symbol Rad17
Ensembl Gene ENSMUSG00000021635
Gene NameRAD17 checkpoint clamp loader component
SynonymsMmRad24, 9430035O09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6730 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location100617164-100651051 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) T to C at 100649745 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022135] [ENSMUST00000022136] [ENSMUST00000084721] [ENSMUST00000167256] [ENSMUST00000177848] [ENSMUST00000185767] [ENSMUST00000187792] [ENSMUST00000190165] [ENSMUST00000190594] [ENSMUST00000190729] [ENSMUST00000226050]
Predicted Effect probably benign
Transcript: ENSMUST00000022135
SMART Domains Protein: ENSMUSP00000022135
Gene: ENSMUSG00000078941

DomainStartEndE-ValueType
Pfam:AAA_17 5 113 1.1e-13 PFAM
Pfam:AAA 6 45 3.6e-6 PFAM
Pfam:AAA_18 6 126 2e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000022136
SMART Domains Protein: ENSMUSP00000022136
Gene: ENSMUSG00000021635

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
AAA 128 280 1.1e-4 SMART
low complexity region 342 355 N/A INTRINSIC
low complexity region 552 567 N/A INTRINSIC
low complexity region 619 635 N/A INTRINSIC
low complexity region 669 687 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084721
SMART Domains Protein: ENSMUSP00000081772
Gene: ENSMUSG00000078941

DomainStartEndE-ValueType
Pfam:TFIID-31kDa 2 130 7.3e-65 PFAM
Pfam:Histone 12 78 2.7e-7 PFAM
Pfam:CENP-S 16 80 7.6e-10 PFAM
low complexity region 248 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167256
SMART Domains Protein: ENSMUSP00000132143
Gene: ENSMUSG00000052293

DomainStartEndE-ValueType
Pfam:TFIID-31kDa 9 129 1.4e-52 PFAM
low complexity region 248 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177848
SMART Domains Protein: ENSMUSP00000136292
Gene: ENSMUSG00000021635

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
AAA 128 280 1.1e-4 SMART
low complexity region 342 355 N/A INTRINSIC
low complexity region 552 567 N/A INTRINSIC
low complexity region 619 635 N/A INTRINSIC
low complexity region 669 687 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185767
SMART Domains Protein: ENSMUSP00000140423
Gene: ENSMUSG00000052293

DomainStartEndE-ValueType
Pfam:TFIID-31kDa 2 130 2.2e-62 PFAM
Pfam:Bromo_TP 12 77 7.6e-5 PFAM
Pfam:CENP-S 15 80 5.7e-7 PFAM
Pfam:Histone 16 78 1e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185901
Predicted Effect probably benign
Transcript: ENSMUST00000187792
SMART Domains Protein: ENSMUSP00000140051
Gene: ENSMUSG00000052293

DomainStartEndE-ValueType
Pfam:TFIID-31kDa 2 130 3e-62 PFAM
Pfam:CENP-S 15 80 6.9e-7 PFAM
Pfam:Histone 16 78 1.3e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190165
SMART Domains Protein: ENSMUSP00000139407
Gene: ENSMUSG00000052293

DomainStartEndE-ValueType
Pfam:TFIID-31kDa 2 130 3.8e-62 PFAM
Pfam:CENP-S 15 80 7.9e-7 PFAM
Pfam:Histone 16 78 1.4e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190210
Predicted Effect probably benign
Transcript: ENSMUST00000190594
SMART Domains Protein: ENSMUSP00000140244
Gene: ENSMUSG00000052293

DomainStartEndE-ValueType
Pfam:TFIID-31kDa 2 130 7.3e-65 PFAM
Pfam:Histone 12 78 2.7e-7 PFAM
Pfam:CENP-S 16 80 7.6e-10 PFAM
low complexity region 248 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190729
Predicted Effect probably benign
Transcript: ENSMUST00000226050
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to the gene product of Schizosaccharomyces pombe rad17, a cell cycle checkpoint gene required for cell cycle arrest and DNA damage repair in response to DNA damage. This protein shares strong similarity with DNA replication factor C (RFC), and can form a complex with RFCs. This protein binds to chromatin prior to DNA damage and is phosphorylated by the checkpoint kinase ATR following damage. This protein recruits the RAD1-RAD9-HUS1 checkpoint protein complex onto chromatin after DNA damage, which may be required for its phosphorylation. The phosphorylation of this protein is required for the DNA-damage-induced cell cycle G2 arrest, and is thought to be a critical early event during checkpoint signaling in DNA-damaged cells. Multiple alternatively spliced transcript variants of this gene, which encode four distinct protein isoforms, have been reported. Two pseudogenes, located on chromosomes 7 and 13, have been identified. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous null mice display embryonic lethality with incomplete somite formation, abnormal bracnchial arch, liver, and heart morphology, abnormal neural tube development, and multiple hemorrhages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930455H04Rik T A 3: 116,983,475 *59R probably null Het
Adam10 G T 9: 70,740,176 probably null Het
Adam2 A T 14: 66,037,576 N569K possibly damaging Het
Adam20 T C 8: 40,796,659 V602A probably benign Het
Adgrb3 T C 1: 25,094,294 Y1237C probably damaging Het
Ago3 T C 4: 126,371,545 T318A probably null Het
Aknad1 G A 3: 108,752,339 G223D possibly damaging Het
Camkv T C 9: 107,948,317 S478P possibly damaging Het
Ccl27a T A 4: 41,773,342 H39L probably damaging Het
Ccser2 C A 14: 36,879,086 S447I probably damaging Het
Clvs2 A G 10: 33,528,521 L233P probably damaging Het
Csn1s2b T A 5: 87,822,268 H124Q probably benign Het
Dnhd1 T C 7: 105,703,875 L2745P probably benign Het
Dync1i2 T A 2: 71,247,140 F219L probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ephb6 C T 6: 41,617,374 Q613* probably null Het
Erc2 A C 14: 27,898,567 D50A possibly damaging Het
Fam149a T A 8: 45,381,174 D196V probably damaging Het
Fam46c T A 3: 100,472,957 N161I probably benign Het
Ficd T C 5: 113,738,712 V316A probably damaging Het
Gstm6 T A 3: 107,942,725 K18* probably null Het
Ighv1-62-1 A T 12: 115,386,892 W52R probably benign Het
Klhl18 C T 9: 110,428,911 C417Y probably damaging Het
Ly9 T A 1: 171,605,169 Y92F probably benign Het
Mettl18 C T 1: 163,997,181 T357I probably damaging Het
Myoz2 C A 3: 123,016,627 G100C probably damaging Het
Olfr1297 A G 2: 111,621,735 V113A probably damaging Het
Olfr517 A T 7: 108,868,573 F194I probably benign Het
Olfr871 T C 9: 20,212,502 I51T probably benign Het
Pars2 C T 4: 106,653,431 L128F probably damaging Het
Pcsk6 G T 7: 65,980,248 R374L probably damaging Het
Ptpn3 T C 4: 57,270,088 T25A probably benign Het
Rab11fip1 G A 8: 27,143,229 P1150S probably damaging Het
Rabep1 A G 11: 70,940,386 Q831R possibly damaging Het
Rxfp1 T A 3: 79,650,591 R527* probably null Het
Scnn1b C T 7: 121,902,877 P253S probably damaging Het
Skiv2l G A 17: 34,845,190 R507* probably null Het
Slc2a7 T C 4: 150,158,148 F231S probably damaging Het
Svil A G 18: 5,049,311 N196S probably benign Het
Urb1 T C 16: 90,779,083 S862G possibly damaging Het
Usp30 T C 5: 114,103,709 S87P probably damaging Het
Vmn1r177 T A 7: 23,865,812 H213L probably damaging Het
Vmn2r106 T A 17: 20,278,834 I272L possibly damaging Het
Vmn2r120 T A 17: 57,525,012 D259V probably benign Het
Other mutations in Rad17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Rad17 APN 13 100629525 missense probably benign 0.03
IGL00422:Rad17 APN 13 100629523 missense probably damaging 0.98
IGL00478:Rad17 APN 13 100633274 missense probably damaging 1.00
IGL01328:Rad17 APN 13 100617803 missense probably benign
IGL01720:Rad17 APN 13 100622858 missense possibly damaging 0.51
IGL01874:Rad17 APN 13 100617684 utr 3 prime probably benign
IGL02305:Rad17 APN 13 100633862 critical splice donor site probably null
IGL02541:Rad17 APN 13 100633443 splice site probably benign
R0678:Rad17 UTSW 13 100645184 missense possibly damaging 0.73
R1079:Rad17 UTSW 13 100633899 missense probably benign 0.01
R1422:Rad17 UTSW 13 100645082 missense probably benign 0.18
R1730:Rad17 UTSW 13 100622806 missense probably damaging 0.97
R3946:Rad17 UTSW 13 100622863 missense possibly damaging 0.70
R4577:Rad17 UTSW 13 100633278 missense probably damaging 1.00
R4735:Rad17 UTSW 13 100619129 missense probably damaging 0.98
R5023:Rad17 UTSW 13 100645063 missense possibly damaging 0.88
R5098:Rad17 UTSW 13 100617646 makesense probably null
R5222:Rad17 UTSW 13 100633891 missense possibly damaging 0.53
R5511:Rad17 UTSW 13 100627649 missense possibly damaging 0.82
R5536:Rad17 UTSW 13 100631104 missense probably damaging 1.00
R5887:Rad17 UTSW 13 100633861 critical splice donor site probably null
R6041:Rad17 UTSW 13 100617766 missense probably benign 0.01
R6173:Rad17 UTSW 13 100622881 missense probably benign
R6342:Rad17 UTSW 13 100619136 missense probably damaging 1.00
R6465:Rad17 UTSW 13 100637080 missense probably benign 0.34
R6890:Rad17 UTSW 13 100637084 missense probably benign 0.34
R6947:Rad17 UTSW 13 100622875 missense probably damaging 1.00
R7035:Rad17 UTSW 13 100627625 missense possibly damaging 0.78
R7113:Rad17 UTSW 13 100629517 missense probably benign 0.03
R7408:Rad17 UTSW 13 100629511 nonsense probably null
R7553:Rad17 UTSW 13 100633286 missense probably damaging 1.00
R7573:Rad17 UTSW 13 100629466 missense probably damaging 0.99
R8313:Rad17 UTSW 13 100624566 missense probably benign 0.02
R8346:Rad17 UTSW 13 100645173 missense possibly damaging 0.77
RF022:Rad17 UTSW 13 100637085 missense probably damaging 1.00
Z1176:Rad17 UTSW 13 100627632 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CACTGGACTATCACTACTTTGACAG -3'
(R):5'- TCCACAGTACTTGGTAGCATG -3'

Sequencing Primer
(F):5'- TCACTACTTTGACAGGCATAAAGC -3'
(R):5'- CTGGGATTTGAACTCAGAACCTTCG -3'
Posted On2018-08-01