Incidental Mutation 'R6730:Adam2'
List |< first << previous [record 3 of 45] next >> last >|
ID530034
Institutional Source Beutler Lab
Gene Symbol Adam2
Ensembl Gene ENSMUSG00000022039
Gene Namea disintegrin and metallopeptidase domain 2
Synonymsfertilin beta, Ftnb, Ph30-beta
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6730 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location66027329-66077733 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 66037576 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 569 (N569K)
Ref Sequence ENSEMBL: ENSMUSP00000022618 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022618]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022618
AA Change: N569K

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022618
Gene: ENSMUSG00000022039
AA Change: N569K

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 17 147 2.1e-26 PFAM
Pfam:Reprolysin 184 381 7.1e-73 PFAM
DISIN 398 474 1.21e-27 SMART
ACR 475 612 6.96e-62 SMART
transmembrane domain 687 709 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is predominantly expressed in the epididymis, where the encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Male mice lacking the encoded protein are infertile and exhibit multiple defects in reproduction. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are viable, females are fertile, but males have severely reduced fertility. Mutant male sperm are defective in sperm-egg membrane adhesion, sperm-egg fusion, migration from the uterus to theoviduct, and binding to the egg zona pellucida. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930455H04Rik T A 3: 116,983,475 *59R probably null Het
Adam10 G T 9: 70,740,176 probably null Het
Adam20 T C 8: 40,796,659 V602A probably benign Het
Adgrb3 T C 1: 25,094,294 Y1237C probably damaging Het
Ago3 T C 4: 126,371,545 T318A probably null Het
Aknad1 G A 3: 108,752,339 G223D possibly damaging Het
Camkv T C 9: 107,948,317 S478P possibly damaging Het
Ccl27a T A 4: 41,773,342 H39L probably damaging Het
Ccser2 C A 14: 36,879,086 S447I probably damaging Het
Clvs2 A G 10: 33,528,521 L233P probably damaging Het
Csn1s2b T A 5: 87,822,268 H124Q probably benign Het
Dnhd1 T C 7: 105,703,875 L2745P probably benign Het
Dync1i2 T A 2: 71,247,140 F219L probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ephb6 C T 6: 41,617,374 Q613* probably null Het
Erc2 A C 14: 27,898,567 D50A possibly damaging Het
Fam149a T A 8: 45,381,174 D196V probably damaging Het
Fam46c T A 3: 100,472,957 N161I probably benign Het
Ficd T C 5: 113,738,712 V316A probably damaging Het
Gstm6 T A 3: 107,942,725 K18* probably null Het
Ighv1-62-1 A T 12: 115,386,892 W52R probably benign Het
Klhl18 C T 9: 110,428,911 C417Y probably damaging Het
Ly9 T A 1: 171,605,169 Y92F probably benign Het
Mettl18 C T 1: 163,997,181 T357I probably damaging Het
Myoz2 C A 3: 123,016,627 G100C probably damaging Het
Olfr1297 A G 2: 111,621,735 V113A probably damaging Het
Olfr517 A T 7: 108,868,573 F194I probably benign Het
Olfr871 T C 9: 20,212,502 I51T probably benign Het
Pars2 C T 4: 106,653,431 L128F probably damaging Het
Pcsk6 G T 7: 65,980,248 R374L probably damaging Het
Ptpn3 T C 4: 57,270,088 T25A probably benign Het
Rab11fip1 G A 8: 27,143,229 P1150S probably damaging Het
Rabep1 A G 11: 70,940,386 Q831R possibly damaging Het
Rad17 T C 13: 100,649,745 probably benign Het
Rxfp1 T A 3: 79,650,591 R527* probably null Het
Scnn1b C T 7: 121,902,877 P253S probably damaging Het
Skiv2l G A 17: 34,845,190 R507* probably null Het
Slc2a7 T C 4: 150,158,148 F231S probably damaging Het
Svil A G 18: 5,049,311 N196S probably benign Het
Urb1 T C 16: 90,779,083 S862G possibly damaging Het
Usp30 T C 5: 114,103,709 S87P probably damaging Het
Vmn1r177 T A 7: 23,865,812 H213L probably damaging Het
Vmn2r106 T A 17: 20,278,834 I272L possibly damaging Het
Vmn2r120 T A 17: 57,525,012 D259V probably benign Het
Other mutations in Adam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Adam2 APN 14 66074049 critical splice donor site probably null
IGL00980:Adam2 APN 14 66056528 nonsense probably null
IGL01404:Adam2 APN 14 66077210 critical splice donor site probably null
IGL01901:Adam2 APN 14 66035229 splice site probably benign
IGL02687:Adam2 APN 14 66069190 missense probably damaging 1.00
IGL02692:Adam2 APN 14 66074087 missense probably damaging 1.00
IGL02695:Adam2 APN 14 66050480 missense probably benign 0.01
IGL02798:Adam2 APN 14 66040275 missense probably damaging 1.00
IGL03217:Adam2 APN 14 66034813 missense possibly damaging 0.85
IGL03256:Adam2 APN 14 66053831 missense probably benign 0.03
sacher UTSW 14 66068558 missense probably damaging 1.00
zuker UTSW 14 66059912 missense probably benign 0.14
R0092:Adam2 UTSW 14 66053887 missense probably damaging 1.00
R0281:Adam2 UTSW 14 66037606 missense probably benign 0.20
R0636:Adam2 UTSW 14 66034816 missense probably benign 0.03
R0690:Adam2 UTSW 14 66057646 missense probably damaging 1.00
R0727:Adam2 UTSW 14 66029731 missense probably damaging 1.00
R1477:Adam2 UTSW 14 66077700 missense possibly damaging 0.96
R1634:Adam2 UTSW 14 66057731 missense probably damaging 1.00
R1652:Adam2 UTSW 14 66077251 missense probably benign 0.41
R1717:Adam2 UTSW 14 66068558 missense probably damaging 1.00
R1868:Adam2 UTSW 14 66077658 missense probably damaging 0.99
R1915:Adam2 UTSW 14 66037557 missense possibly damaging 0.95
R3748:Adam2 UTSW 14 66059912 missense probably benign 0.14
R3953:Adam2 UTSW 14 66057610 missense probably damaging 1.00
R3954:Adam2 UTSW 14 66057610 missense probably damaging 1.00
R3955:Adam2 UTSW 14 66057610 missense probably damaging 1.00
R3956:Adam2 UTSW 14 66057610 missense probably damaging 1.00
R3957:Adam2 UTSW 14 66057610 missense probably damaging 1.00
R4091:Adam2 UTSW 14 66029723 missense probably damaging 0.97
R5673:Adam2 UTSW 14 66069232 missense probably benign 0.03
R5761:Adam2 UTSW 14 66046146 missense probably damaging 1.00
R6187:Adam2 UTSW 14 66068619 missense possibly damaging 0.89
R6499:Adam2 UTSW 14 66058790 missense probably damaging 1.00
R6829:Adam2 UTSW 14 66027997 critical splice donor site probably null
R7023:Adam2 UTSW 14 66043056 missense probably benign 0.22
R7168:Adam2 UTSW 14 66058792 missense possibly damaging 0.89
R7228:Adam2 UTSW 14 66053912 nonsense probably null
R7293:Adam2 UTSW 14 66035185 missense probably benign 0.29
R7604:Adam2 UTSW 14 66056541 missense probably benign 0.17
R7765:Adam2 UTSW 14 66059896 missense probably damaging 1.00
R8380:Adam2 UTSW 14 66037557 missense probably benign 0.01
X0061:Adam2 UTSW 14 66053905 missense possibly damaging 0.66
Z1177:Adam2 UTSW 14 66056521 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAACTTCTATGTGGGATTGCAC -3'
(R):5'- TGTGGTATCCAAAACTAACTGCG -3'

Sequencing Primer
(F):5'- GGGATTGCACACTTACATTTCGAGAG -3'
(R):5'- GGTATCCAAAACTAACTGCGTATATC -3'
Posted On2018-08-01