Incidental Mutation 'R6730:Skiv2l'
ID530037
Institutional Source Beutler Lab
Gene Symbol Skiv2l
Ensembl Gene ENSMUSG00000040356
Gene Namesuperkiller viralicidic activity 2-like (S. cerevisiae)
Synonyms4930534J06Rik, Ski2w
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6730 (G1)
Quality Score164.009
Status Validated
Chromosome17
Chromosomal Location34839228-34850210 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 34845190 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 507 (R507*)
Ref Sequence ENSEMBL: ENSMUSP00000036265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046022] [ENSMUST00000172966] [ENSMUST00000173415]
Predicted Effect probably null
Transcript: ENSMUST00000046022
AA Change: R507*
SMART Domains Protein: ENSMUSP00000036265
Gene: ENSMUSG00000040356
AA Change: R507*

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
low complexity region 171 176 N/A INTRINSIC
low complexity region 208 237 N/A INTRINSIC
low complexity region 269 279 N/A INTRINSIC
DEXDc 304 487 3.61e-28 SMART
low complexity region 583 592 N/A INTRINSIC
HELICc 619 705 8.63e-17 SMART
Pfam:rRNA_proc-arch 760 1044 9.7e-39 PFAM
DSHCT 1067 1243 7.67e-77 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172803
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172878
Predicted Effect probably benign
Transcript: ENSMUST00000172966
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173305
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173403
Predicted Effect probably benign
Transcript: ENSMUST00000173415
SMART Domains Protein: ENSMUSP00000134209
Gene: ENSMUSG00000040356

DomainStartEndE-ValueType
PDB:4A4Z|A 10 81 8e-14 PDB
Blast:DEXDc 19 76 2e-29 BLAST
Blast:DEXDc 136 242 9e-28 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174887
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184474
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a human homologue of yeast SKI2 and may be involved in antiviral activity by blocking translation of poly(A) deficient mRNAs. This gene is located in the class III region of the major histocompatibility complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930455H04Rik T A 3: 116,983,475 *59R probably null Het
Adam10 G T 9: 70,740,176 probably null Het
Adam2 A T 14: 66,037,576 N569K possibly damaging Het
Adam20 T C 8: 40,796,659 V602A probably benign Het
Adgrb3 T C 1: 25,094,294 Y1237C probably damaging Het
Ago3 T C 4: 126,371,545 T318A probably null Het
Aknad1 G A 3: 108,752,339 G223D possibly damaging Het
Camkv T C 9: 107,948,317 S478P possibly damaging Het
Ccl27a T A 4: 41,773,342 H39L probably damaging Het
Ccser2 C A 14: 36,879,086 S447I probably damaging Het
Clvs2 A G 10: 33,528,521 L233P probably damaging Het
Csn1s2b T A 5: 87,822,268 H124Q probably benign Het
Dnhd1 T C 7: 105,703,875 L2745P probably benign Het
Dync1i2 T A 2: 71,247,140 F219L probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ephb6 C T 6: 41,617,374 Q613* probably null Het
Erc2 A C 14: 27,898,567 D50A possibly damaging Het
Fam149a T A 8: 45,381,174 D196V probably damaging Het
Fam46c T A 3: 100,472,957 N161I probably benign Het
Ficd T C 5: 113,738,712 V316A probably damaging Het
Gstm6 T A 3: 107,942,725 K18* probably null Het
Ighv1-62-1 A T 12: 115,386,892 W52R probably benign Het
Klhl18 C T 9: 110,428,911 C417Y probably damaging Het
Ly9 T A 1: 171,605,169 Y92F probably benign Het
Mettl18 C T 1: 163,997,181 T357I probably damaging Het
Myoz2 C A 3: 123,016,627 G100C probably damaging Het
Olfr1297 A G 2: 111,621,735 V113A probably damaging Het
Olfr517 A T 7: 108,868,573 F194I probably benign Het
Olfr871 T C 9: 20,212,502 I51T probably benign Het
Pars2 C T 4: 106,653,431 L128F probably damaging Het
Pcsk6 G T 7: 65,980,248 R374L probably damaging Het
Ptpn3 T C 4: 57,270,088 T25A probably benign Het
Rab11fip1 G A 8: 27,143,229 P1150S probably damaging Het
Rabep1 A G 11: 70,940,386 Q831R possibly damaging Het
Rad17 T C 13: 100,649,745 probably benign Het
Rxfp1 T A 3: 79,650,591 R527* probably null Het
Scnn1b C T 7: 121,902,877 P253S probably damaging Het
Slc2a7 T C 4: 150,158,148 F231S probably damaging Het
Svil A G 18: 5,049,311 N196S probably benign Het
Urb1 T C 16: 90,779,083 S862G possibly damaging Het
Usp30 T C 5: 114,103,709 S87P probably damaging Het
Vmn1r177 T A 7: 23,865,812 H213L probably damaging Het
Vmn2r106 T A 17: 20,278,834 I272L possibly damaging Het
Vmn2r120 T A 17: 57,525,012 D259V probably benign Het
Other mutations in Skiv2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Skiv2l APN 17 34839548 missense probably damaging 1.00
IGL00338:Skiv2l APN 17 34846667 missense probably damaging 0.99
IGL01284:Skiv2l APN 17 34839688 unclassified probably benign
IGL01308:Skiv2l APN 17 34840634 missense probably benign 0.19
IGL01874:Skiv2l APN 17 34841209 missense probably benign
IGL02114:Skiv2l APN 17 34841116 missense probably damaging 0.97
IGL02208:Skiv2l APN 17 34841675 missense probably damaging 0.99
IGL02274:Skiv2l APN 17 34845863 missense probably damaging 1.00
IGL02729:Skiv2l APN 17 34839605 missense possibly damaging 0.63
IGL02839:Skiv2l APN 17 34847798 missense probably benign
R0325:Skiv2l UTSW 17 34844815 missense possibly damaging 0.50
R1102:Skiv2l UTSW 17 34840106 missense probably benign 0.28
R1294:Skiv2l UTSW 17 34841064 splice site probably null
R1513:Skiv2l UTSW 17 34847444 missense probably damaging 1.00
R1557:Skiv2l UTSW 17 34848422 missense probably damaging 1.00
R1747:Skiv2l UTSW 17 34847806 missense probably benign 0.02
R2401:Skiv2l UTSW 17 34840385 missense probably benign
R3162:Skiv2l UTSW 17 34847813 nonsense probably null
R3162:Skiv2l UTSW 17 34847813 nonsense probably null
R3695:Skiv2l UTSW 17 34847912 missense probably damaging 1.00
R3700:Skiv2l UTSW 17 34849903 missense probably benign
R4654:Skiv2l UTSW 17 34849946 missense probably damaging 1.00
R4736:Skiv2l UTSW 17 34848197 missense possibly damaging 0.91
R4835:Skiv2l UTSW 17 34842921 missense possibly damaging 0.66
R5014:Skiv2l UTSW 17 34847425 missense probably benign 0.00
R5181:Skiv2l UTSW 17 34844826 missense probably benign 0.44
R5223:Skiv2l UTSW 17 34845166 critical splice donor site probably null
R5417:Skiv2l UTSW 17 34846598 missense probably damaging 0.98
R5623:Skiv2l UTSW 17 34847432 missense probably benign 0.00
R5878:Skiv2l UTSW 17 34846117 missense possibly damaging 0.83
R5979:Skiv2l UTSW 17 34841463 missense probably benign 0.01
R6412:Skiv2l UTSW 17 34840300 missense possibly damaging 0.92
R6501:Skiv2l UTSW 17 34844436 missense possibly damaging 0.95
R6532:Skiv2l UTSW 17 34844743 missense probably damaging 1.00
R6732:Skiv2l UTSW 17 34845190 nonsense probably null
R6741:Skiv2l UTSW 17 34845190 nonsense probably null
R6742:Skiv2l UTSW 17 34845190 nonsense probably null
R6769:Skiv2l UTSW 17 34845190 nonsense probably null
R6771:Skiv2l UTSW 17 34845190 nonsense probably null
R7022:Skiv2l UTSW 17 34845207 missense possibly damaging 0.88
R7096:Skiv2l UTSW 17 34841470 missense probably benign
R7178:Skiv2l UTSW 17 34839464 missense probably benign
R7315:Skiv2l UTSW 17 34841169 missense probably benign 0.00
R7584:Skiv2l UTSW 17 34841675 missense possibly damaging 0.69
R7677:Skiv2l UTSW 17 34848164 missense probably benign 0.03
R7796:Skiv2l UTSW 17 34844418 missense probably damaging 1.00
R8071:Skiv2l UTSW 17 34849999 missense probably benign 0.22
R8407:Skiv2l UTSW 17 34841127 missense probably benign 0.00
Z1176:Skiv2l UTSW 17 34841546 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAGATTGAGTGGTCCCAGC -3'
(R):5'- TGAACCGGTTGGATCAGAAG -3'

Sequencing Primer
(F):5'- AGCCCTCACCTGTGCAG -3'
(R):5'- CCGGTTGGATCAGAAGTGGAG -3'
Posted On2018-08-01