Incidental Mutation 'R6730:Svil'
ID530039
Institutional Source Beutler Lab
Gene Symbol Svil
Ensembl Gene ENSMUSG00000024236
Gene Namesupervillin
SynonymsB430302E16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R6730 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location4920540-5119299 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5049311 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 196 (N196S)
Ref Sequence ENSEMBL: ENSMUSP00000122242 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025079] [ENSMUST00000126977] [ENSMUST00000127297] [ENSMUST00000131609] [ENSMUST00000140448] [ENSMUST00000143254] [ENSMUST00000153016] [ENSMUST00000210707]
Predicted Effect probably benign
Transcript: ENSMUST00000025079
AA Change: N196S

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000025079
Gene: ENSMUSG00000024236
AA Change: N196S

DomainStartEndE-ValueType
low complexity region 1181 1191 N/A INTRINSIC
GEL 1397 1496 4.58e-22 SMART
GEL 1521 1638 4.03e-1 SMART
GEL 1708 1818 2.93e-20 SMART
low complexity region 1825 1831 N/A INTRINSIC
GEL 1837 1938 1.72e-17 SMART
GEL 1971 2078 1.37e0 SMART
VHP 2135 2170 1.15e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126977
AA Change: N196S

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000115078
Gene: ENSMUSG00000024236
AA Change: N196S

DomainStartEndE-ValueType
low complexity region 1181 1191 N/A INTRINSIC
GEL 1397 1496 4.58e-22 SMART
GEL 1521 1638 4.03e-1 SMART
GEL 1708 1818 2.93e-20 SMART
low complexity region 1825 1831 N/A INTRINSIC
GEL 1837 1938 1.72e-17 SMART
GEL 1971 2078 1.37e0 SMART
VHP 2135 2170 1.15e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127297
AA Change: N196S

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000115223
Gene: ENSMUSG00000024236
AA Change: N196S

DomainStartEndE-ValueType
low complexity region 1067 1077 N/A INTRINSIC
GEL 1283 1382 4.58e-22 SMART
GEL 1407 1524 4.03e-1 SMART
GEL 1594 1704 2.93e-20 SMART
low complexity region 1711 1717 N/A INTRINSIC
GEL 1723 1824 1.72e-17 SMART
GEL 1857 1964 1.37e0 SMART
VHP 2021 2056 1.15e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131210
Predicted Effect probably benign
Transcript: ENSMUST00000131609
AA Change: N196S

PolyPhen 2 Score 0.165 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000122242
Gene: ENSMUSG00000024236
AA Change: N196S

DomainStartEndE-ValueType
low complexity region 1181 1191 N/A INTRINSIC
GEL 1397 1496 2.9e-24 SMART
GEL 1521 1638 2.5e-3 SMART
GEL 1708 1818 1.9e-22 SMART
low complexity region 1825 1831 N/A INTRINSIC
GEL 1837 1938 1.1e-19 SMART
low complexity region 1965 1974 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138258
Predicted Effect probably benign
Transcript: ENSMUST00000140448
AA Change: N196S

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000119803
Gene: ENSMUSG00000024236
AA Change: N196S

DomainStartEndE-ValueType
low complexity region 1181 1191 N/A INTRINSIC
GEL 1397 1496 4.58e-22 SMART
GEL 1521 1638 4.03e-1 SMART
GEL 1708 1818 2.93e-20 SMART
low complexity region 1825 1831 N/A INTRINSIC
GEL 1837 1938 1.72e-17 SMART
GEL 1971 2078 1.37e0 SMART
VHP 2135 2170 1.15e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143254
AA Change: N196S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119287
Gene: ENSMUSG00000024236
AA Change: N196S

DomainStartEndE-ValueType
low complexity region 777 787 N/A INTRINSIC
GEL 993 1092 4.58e-22 SMART
GEL 1117 1234 4.03e-1 SMART
GEL 1304 1414 2.93e-20 SMART
low complexity region 1421 1427 N/A INTRINSIC
GEL 1433 1534 1.72e-17 SMART
GEL 1567 1674 1.37e0 SMART
VHP 1731 1766 1.15e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153016
Predicted Effect probably benign
Transcript: ENSMUST00000210707
AA Change: N283S

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.0585 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bipartite protein with distinct amino- and carboxy-terminal domains. The amino-terminus contains nuclear localization signals and the carboxy-terminus contains numerous consecutive sequences with extensive similarity to proteins in the gelsolin family of actin-binding proteins, which cap, nucleate, and/or sever actin filaments. The gene product is tightly associated with both actin filaments and plasma membranes, suggesting a role as a high-affinity link between the actin cytoskeleton and the membrane. The encoded protein appears to aid in both myosin II assembly during cell spreading and disassembly of focal adhesions. Several transcript variants encoding different isoforms of supervillin have been described. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanched adhesion and thrombus formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930455H04Rik T A 3: 116,983,475 *59R probably null Het
Adam10 G T 9: 70,740,176 probably null Het
Adam2 A T 14: 66,037,576 N569K possibly damaging Het
Adam20 T C 8: 40,796,659 V602A probably benign Het
Adgrb3 T C 1: 25,094,294 Y1237C probably damaging Het
Ago3 T C 4: 126,371,545 T318A probably null Het
Aknad1 G A 3: 108,752,339 G223D possibly damaging Het
Camkv T C 9: 107,948,317 S478P possibly damaging Het
Ccl27a T A 4: 41,773,342 H39L probably damaging Het
Ccser2 C A 14: 36,879,086 S447I probably damaging Het
Clvs2 A G 10: 33,528,521 L233P probably damaging Het
Csn1s2b T A 5: 87,822,268 H124Q probably benign Het
Dnhd1 T C 7: 105,703,875 L2745P probably benign Het
Dync1i2 T A 2: 71,247,140 F219L probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ephb6 C T 6: 41,617,374 Q613* probably null Het
Erc2 A C 14: 27,898,567 D50A possibly damaging Het
Fam149a T A 8: 45,381,174 D196V probably damaging Het
Fam46c T A 3: 100,472,957 N161I probably benign Het
Ficd T C 5: 113,738,712 V316A probably damaging Het
Gstm6 T A 3: 107,942,725 K18* probably null Het
Ighv1-62-1 A T 12: 115,386,892 W52R probably benign Het
Klhl18 C T 9: 110,428,911 C417Y probably damaging Het
Ly9 T A 1: 171,605,169 Y92F probably benign Het
Mettl18 C T 1: 163,997,181 T357I probably damaging Het
Myoz2 C A 3: 123,016,627 G100C probably damaging Het
Olfr1297 A G 2: 111,621,735 V113A probably damaging Het
Olfr517 A T 7: 108,868,573 F194I probably benign Het
Olfr871 T C 9: 20,212,502 I51T probably benign Het
Pars2 C T 4: 106,653,431 L128F probably damaging Het
Pcsk6 G T 7: 65,980,248 R374L probably damaging Het
Ptpn3 T C 4: 57,270,088 T25A probably benign Het
Rab11fip1 G A 8: 27,143,229 P1150S probably damaging Het
Rabep1 A G 11: 70,940,386 Q831R possibly damaging Het
Rad17 T C 13: 100,649,745 probably benign Het
Rxfp1 T A 3: 79,650,591 R527* probably null Het
Scnn1b C T 7: 121,902,877 P253S probably damaging Het
Skiv2l G A 17: 34,845,190 R507* probably null Het
Slc2a7 T C 4: 150,158,148 F231S probably damaging Het
Urb1 T C 16: 90,779,083 S862G possibly damaging Het
Usp30 T C 5: 114,103,709 S87P probably damaging Het
Vmn1r177 T A 7: 23,865,812 H213L probably damaging Het
Vmn2r106 T A 17: 20,278,834 I272L possibly damaging Het
Vmn2r120 T A 17: 57,525,012 D259V probably benign Het
Other mutations in Svil
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Svil APN 18 5099045 missense probably benign 0.27
IGL00840:Svil APN 18 5063555 missense probably benign
IGL01329:Svil APN 18 5064501 missense probably benign
IGL01446:Svil APN 18 5062385 missense probably damaging 1.00
IGL02068:Svil APN 18 5092899 missense probably damaging 1.00
IGL02223:Svil APN 18 5105879 splice site probably benign
IGL02428:Svil APN 18 5118203 missense probably damaging 1.00
IGL02429:Svil APN 18 5118369 missense probably benign 0.00
IGL02479:Svil APN 18 5099476 missense probably damaging 1.00
IGL02560:Svil APN 18 5049379 missense probably benign 0.00
IGL02652:Svil APN 18 5114531 missense probably damaging 1.00
IGL03291:Svil APN 18 5056150 nonsense probably null
BB002:Svil UTSW 18 5118357 missense probably benign 0.00
BB012:Svil UTSW 18 5118357 missense probably benign 0.00
IGL03055:Svil UTSW 18 5108615 missense probably damaging 1.00
R0029:Svil UTSW 18 5063286 missense probably benign 0.14
R0029:Svil UTSW 18 5063286 missense probably benign 0.14
R0266:Svil UTSW 18 5099063 splice site probably benign
R0281:Svil UTSW 18 5094582 missense probably damaging 1.00
R0442:Svil UTSW 18 5046870 missense probably damaging 1.00
R0549:Svil UTSW 18 5064566 missense possibly damaging 0.79
R0617:Svil UTSW 18 5117002 missense probably damaging 1.00
R0801:Svil UTSW 18 5099443 missense probably benign 0.00
R0894:Svil UTSW 18 5097494 missense probably damaging 1.00
R1053:Svil UTSW 18 5056690 missense probably benign 0.16
R1065:Svil UTSW 18 5063777 splice site probably benign
R1080:Svil UTSW 18 5058147 missense possibly damaging 0.79
R1199:Svil UTSW 18 5059217 splice site probably benign
R1472:Svil UTSW 18 5048950 missense probably benign 0.09
R1480:Svil UTSW 18 5057345 missense probably damaging 1.00
R1544:Svil UTSW 18 5046817 missense possibly damaging 0.93
R1626:Svil UTSW 18 5117099 critical splice donor site probably null
R1691:Svil UTSW 18 5056336 missense probably benign 0.06
R1812:Svil UTSW 18 5097545 missense probably damaging 1.00
R1826:Svil UTSW 18 5063383 missense probably benign 0.01
R1842:Svil UTSW 18 5062373 missense probably damaging 1.00
R1884:Svil UTSW 18 5094640 missense possibly damaging 0.94
R1945:Svil UTSW 18 5117059 missense probably damaging 1.00
R2184:Svil UTSW 18 5099534 missense probably damaging 1.00
R2184:Svil UTSW 18 5099615 missense probably damaging 1.00
R2232:Svil UTSW 18 5046640 start codon destroyed probably null 0.98
R2398:Svil UTSW 18 5060613 splice site probably null
R3076:Svil UTSW 18 5116055 missense probably damaging 1.00
R3777:Svil UTSW 18 5090855 missense probably damaging 0.97
R3779:Svil UTSW 18 5090855 missense probably damaging 0.97
R3797:Svil UTSW 18 5060534 missense probably benign 0.29
R4077:Svil UTSW 18 5063522 missense probably benign 0.03
R4350:Svil UTSW 18 5118154 missense probably damaging 1.00
R4379:Svil UTSW 18 5046909 missense probably damaging 1.00
R4488:Svil UTSW 18 5049067 missense probably damaging 1.00
R4777:Svil UTSW 18 5088813 missense probably damaging 0.99
R4825:Svil UTSW 18 5114564 missense probably damaging 1.00
R4921:Svil UTSW 18 5108631 missense probably damaging 1.00
R4969:Svil UTSW 18 5095516 missense probably damaging 1.00
R4975:Svil UTSW 18 5054025 missense possibly damaging 0.61
R4990:Svil UTSW 18 5056810 missense probably benign 0.05
R4991:Svil UTSW 18 5056810 missense probably benign 0.05
R5061:Svil UTSW 18 5048954 missense probably benign 0.02
R5271:Svil UTSW 18 5062329 missense probably benign 0.45
R5362:Svil UTSW 18 5057345 missense probably damaging 1.00
R5433:Svil UTSW 18 5059294 missense probably damaging 0.99
R5677:Svil UTSW 18 5046823 nonsense probably null
R5850:Svil UTSW 18 5098900 splice site probably null
R5868:Svil UTSW 18 5056854 splice site probably null
R5871:Svil UTSW 18 5103669 splice site probably null
R5876:Svil UTSW 18 5082828 missense probably damaging 1.00
R6061:Svil UTSW 18 5106724 missense probably damaging 1.00
R6062:Svil UTSW 18 5106724 missense probably damaging 1.00
R6063:Svil UTSW 18 5106724 missense probably damaging 1.00
R6065:Svil UTSW 18 5106724 missense probably damaging 1.00
R6066:Svil UTSW 18 5106724 missense probably damaging 1.00
R6114:Svil UTSW 18 5108639 missense probably damaging 1.00
R6115:Svil UTSW 18 5108675 missense probably damaging 0.99
R6117:Svil UTSW 18 5116016 missense probably damaging 1.00
R6302:Svil UTSW 18 5057432 missense probably benign 0.13
R6418:Svil UTSW 18 5040171 missense probably benign 0.26
R6441:Svil UTSW 18 5049323 missense probably benign
R6446:Svil UTSW 18 5057323 missense probably benign 0.09
R6455:Svil UTSW 18 5056629 missense possibly damaging 0.89
R6545:Svil UTSW 18 5108621 missense probably benign 0.00
R6692:Svil UTSW 18 5082853 missense probably damaging 1.00
R6763:Svil UTSW 18 5056437 missense probably damaging 0.99
R6870:Svil UTSW 18 5063231 missense possibly damaging 0.86
R6916:Svil UTSW 18 5114682 utr 3 prime probably benign
R7134:Svil UTSW 18 5116080 missense probably damaging 1.00
R7190:Svil UTSW 18 5092937 missense probably benign 0.01
R7213:Svil UTSW 18 5094574 missense probably damaging 0.99
R7249:Svil UTSW 18 5056270 missense probably benign 0.01
R7249:Svil UTSW 18 5062247 missense probably damaging 0.99
R7421:Svil UTSW 18 5056109 missense probably benign 0.18
R7571:Svil UTSW 18 5114636 missense probably damaging 1.00
R7574:Svil UTSW 18 5095188 missense probably benign 0.16
R7645:Svil UTSW 18 5099663 missense probably damaging 1.00
R7925:Svil UTSW 18 5118357 missense probably benign 0.00
R8113:Svil UTSW 18 5062385 missense probably damaging 1.00
R8263:Svil UTSW 18 5108679 missense probably damaging 1.00
X0065:Svil UTSW 18 5062317 missense probably damaging 1.00
Z1177:Svil UTSW 18 5062344 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTCTCGATATGCCAAGTCTC -3'
(R):5'- TCAATGCTTACCTGGCTCGG -3'

Sequencing Primer
(F):5'- TCTCGATATGCCAAGTCTCGGAAG -3'
(R):5'- GCTCGGGCCTCTGTGGG -3'
Posted On2018-08-01