Incidental Mutation 'R6731:Cps1'
ID530040
Institutional Source Beutler Lab
Gene Symbol Cps1
Ensembl Gene ENSMUSG00000025991
Gene Namecarbamoyl-phosphate synthetase 1
SynonymsCPSase I, D1Ucla3, CPS, 4732433M03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6731 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location67123026-67231259 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67160871 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 393 (S393P)
Ref Sequence ENSEMBL: ENSMUSP00000027144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027144]
Predicted Effect probably damaging
Transcript: ENSMUST00000027144
AA Change: S393P

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027144
Gene: ENSMUSG00000025991
AA Change: S393P

DomainStartEndE-ValueType
CPSase_sm_chain 44 184 2.5e-70 SMART
Pfam:GATase 221 397 1.5e-40 PFAM
low complexity region 426 436 N/A INTRINSIC
Pfam:ATP-grasp_4 543 724 6.8e-12 PFAM
Pfam:CPSase_L_D2 546 750 1.7e-85 PFAM
Pfam:ATP-grasp 554 722 4.9e-8 PFAM
Pfam:Dala_Dala_lig_C 561 718 1.5e-7 PFAM
CPSase_L_D3 839 962 1.18e-57 SMART
Pfam:ATP-grasp_4 1085 1264 1e-19 PFAM
Pfam:CPSase_L_D2 1088 1291 7.4e-32 PFAM
Pfam:Dala_Dala_lig_C 1095 1279 1.6e-6 PFAM
Pfam:ATP-grasp 1096 1263 2.8e-12 PFAM
MGS 1373 1465 1.53e-15 SMART
Meta Mutation Damage Score 0.2576 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.3%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: This gene encodes a protein localized to the inner mitochondrial matrix. The encoded protein plays a role in the detoxification of ammonia by catalyzing the first step in the urea cycle in which carbomyl-phosphate is synthesized from ammonia and bicarbonate. Carbamoyl-phosphate is subsequently converted to urea that is excreted by the kidneys. Deficiency of the encoded enzyme leads to an accumulation of ammonia in the blood. High levels of ammonia are toxic to the central nervous system and result in neurological disorders. [provided by RefSeq, Oct 2013]
PHENOTYPE: Homozygous mutation of this gene results in death by 36 hours after birth and hyperammonemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A G 17: 33,066,226 V534A probably benign Het
Acta1 G A 8: 123,893,217 T128I probably damaging Het
Ahnak T A 19: 9,011,562 D3403E possibly damaging Het
Aldoc T A 11: 78,326,092 D319E probably benign Het
Ank3 T A 10: 70,014,028 D1108E possibly damaging Het
Ankrd7 G A 6: 18,866,654 G58S probably damaging Het
Ass1 A T 2: 31,514,784 Y359F probably damaging Het
B3gnt2 G T 11: 22,836,888 S100* probably null Het
Cd46 T C 1: 195,083,467 probably null Het
Chst5 G T 8: 111,890,044 R315S probably benign Het
Dis3l T C 9: 64,310,438 probably null Het
Fgg T C 3: 83,012,901 F329S probably damaging Het
Hsp90b1 T C 10: 86,701,905 T179A probably benign Het
Kat2a A T 11: 100,708,273 M559K probably damaging Het
Klhl41 T C 2: 69,674,700 I449T probably damaging Het
Lama5 A T 2: 180,188,574 I1880N probably benign Het
Lcp1 A G 14: 75,206,189 D215G probably damaging Het
Lrch3 A G 16: 32,950,420 T131A probably damaging Het
Mroh6 T C 15: 75,888,492 T78A probably benign Het
Naa15 T G 3: 51,455,873 V326G probably damaging Het
Nalcn T A 14: 123,599,934 Q6L probably benign Het
Nipbl T A 15: 8,322,590 I1863L probably damaging Het
Os9 C T 10: 127,098,543 G408D probably benign Het
Pcbp2 T C 15: 102,488,790 S237P probably damaging Het
Pcdhb10 G A 18: 37,413,476 R535H probably benign Het
Pex5l A T 3: 32,958,798 I320K probably damaging Het
Pgm1 T C 5: 64,100,975 F101S probably benign Het
Poc1b T A 10: 99,152,871 D207E probably null Het
Pou6f1 T C 15: 100,579,883 I460V possibly damaging Het
Rnf17 A T 14: 56,524,350 Q1623H possibly damaging Het
Rnf219 C T 14: 104,479,474 V488I probably benign Het
Rpap1 T C 2: 119,778,296 N195S probably benign Het
Sacs C A 14: 61,180,700 probably null Het
Scube2 G A 7: 109,810,737 T643M probably damaging Het
Sele C T 1: 164,053,673 L481F probably damaging Het
Stk32a A G 18: 43,305,078 Y214C probably damaging Het
Tex44 T A 1: 86,426,485 S39T probably benign Het
Tmem135 A T 7: 89,243,964 M140K possibly damaging Het
Tox2 A G 2: 163,320,377 Y354C probably damaging Het
Trim21 A T 7: 102,559,212 F433L probably damaging Het
Trim24 T C 6: 37,943,485 F406L probably damaging Het
Ubr1 G C 2: 120,955,640 H166Q probably null Het
Wnt16 T A 6: 22,297,892 Y252* probably null Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zfp141 T C 7: 42,489,500 D36G probably damaging Het
Zfp729a C T 13: 67,620,146 V655I probably benign Het
Zfp974 A T 7: 27,911,649 V217E possibly damaging Het
Other mutations in Cps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Cps1 APN 1 67152380 splice site probably benign
IGL00897:Cps1 APN 1 67215564 missense probably benign 0.08
IGL00928:Cps1 APN 1 67123234 missense probably benign
IGL01063:Cps1 APN 1 67195166 missense possibly damaging 0.91
IGL01081:Cps1 APN 1 67206824 missense probably damaging 1.00
IGL01361:Cps1 APN 1 67195145 missense probably benign 0.03
IGL01396:Cps1 APN 1 67157786 missense probably damaging 1.00
IGL01516:Cps1 APN 1 67230284 missense probably damaging 0.99
IGL01695:Cps1 APN 1 67197035 missense probably benign
IGL02022:Cps1 APN 1 67172872 splice site probably benign
IGL02032:Cps1 APN 1 67230315 missense probably benign 0.03
IGL02049:Cps1 APN 1 67143954 missense possibly damaging 0.68
IGL02197:Cps1 APN 1 67157764 missense probably benign
IGL02217:Cps1 APN 1 67174382 missense probably benign 0.06
IGL02555:Cps1 APN 1 67214021 missense probably benign 0.06
IGL02570:Cps1 APN 1 67148703 splice site probably benign
IGL02633:Cps1 APN 1 67123237 missense probably benign
IGL02711:Cps1 APN 1 67212517 splice site probably benign
IGL02737:Cps1 APN 1 67148774 missense probably benign 0.35
IGL03030:Cps1 APN 1 67142921 missense probably damaging 1.00
IGL03255:Cps1 APN 1 67145801 nonsense probably null
Madman UTSW 1 67160871 missense probably damaging 0.96
maniac UTSW 1 67157878 critical splice donor site probably null
R0109:Cps1 UTSW 1 67229418 missense possibly damaging 0.82
R0109:Cps1 UTSW 1 67229418 missense possibly damaging 0.82
R0140:Cps1 UTSW 1 67180116 missense probably benign
R0318:Cps1 UTSW 1 67177014 missense probably damaging 0.99
R0486:Cps1 UTSW 1 67165392 missense probably damaging 1.00
R0488:Cps1 UTSW 1 67148808 splice site probably benign
R0492:Cps1 UTSW 1 67157836 missense probably damaging 1.00
R0521:Cps1 UTSW 1 67215564 missense probably benign 0.02
R0534:Cps1 UTSW 1 67143900 missense probably benign 0.06
R0565:Cps1 UTSW 1 67166449 missense possibly damaging 0.57
R0609:Cps1 UTSW 1 67172802 missense probably damaging 1.00
R0612:Cps1 UTSW 1 67139770 missense probably benign 0.01
R1185:Cps1 UTSW 1 67195199 missense probably benign 0.00
R1185:Cps1 UTSW 1 67195199 missense probably benign 0.00
R1185:Cps1 UTSW 1 67195199 missense probably benign 0.00
R1220:Cps1 UTSW 1 67204703 critical splice donor site probably null
R1321:Cps1 UTSW 1 67143019 splice site probably benign
R1343:Cps1 UTSW 1 67209609 missense probably damaging 1.00
R1373:Cps1 UTSW 1 67229424 missense possibly damaging 0.89
R1374:Cps1 UTSW 1 67230281 missense probably damaging 0.97
R1481:Cps1 UTSW 1 67143882 missense probably damaging 0.99
R1711:Cps1 UTSW 1 67168374 splice site probably null
R1712:Cps1 UTSW 1 67230281 missense probably damaging 0.97
R1774:Cps1 UTSW 1 67170882 missense possibly damaging 0.94
R1799:Cps1 UTSW 1 67209642 missense probably damaging 1.00
R1954:Cps1 UTSW 1 67195196 missense possibly damaging 0.71
R2074:Cps1 UTSW 1 67204638 missense probably benign 0.21
R2078:Cps1 UTSW 1 67157806 missense probably damaging 1.00
R2078:Cps1 UTSW 1 67195265 missense possibly damaging 0.74
R2111:Cps1 UTSW 1 67176980 missense probably benign 0.01
R2112:Cps1 UTSW 1 67176980 missense probably benign 0.01
R2146:Cps1 UTSW 1 67152379 splice site probably benign
R2355:Cps1 UTSW 1 67156224 missense probably damaging 1.00
R2375:Cps1 UTSW 1 67217860 missense probably benign 0.00
R2860:Cps1 UTSW 1 67166375 missense probably benign 0.44
R2861:Cps1 UTSW 1 67166375 missense probably benign 0.44
R2979:Cps1 UTSW 1 67204704 critical splice donor site probably null
R3427:Cps1 UTSW 1 67174494 missense probably damaging 1.00
R3833:Cps1 UTSW 1 67139787 missense probably damaging 1.00
R3857:Cps1 UTSW 1 67168278 missense probably damaging 1.00
R3858:Cps1 UTSW 1 67168278 missense probably damaging 1.00
R3859:Cps1 UTSW 1 67168278 missense probably damaging 1.00
R3886:Cps1 UTSW 1 67165500 missense possibly damaging 0.83
R3887:Cps1 UTSW 1 67165500 missense possibly damaging 0.83
R3888:Cps1 UTSW 1 67165500 missense possibly damaging 0.83
R3889:Cps1 UTSW 1 67165500 missense possibly damaging 0.83
R4386:Cps1 UTSW 1 67170995 critical splice donor site probably null
R4497:Cps1 UTSW 1 67205199 missense probably null 1.00
R4671:Cps1 UTSW 1 67196560 missense probably damaging 1.00
R4774:Cps1 UTSW 1 67220512 missense probably damaging 0.99
R4799:Cps1 UTSW 1 67142986 missense probably damaging 0.96
R4853:Cps1 UTSW 1 67156202 missense possibly damaging 0.51
R4884:Cps1 UTSW 1 67177024 missense probably benign 0.11
R4900:Cps1 UTSW 1 67160904 missense probably damaging 1.00
R4906:Cps1 UTSW 1 67139763 missense probably benign 0.10
R5091:Cps1 UTSW 1 67229520 critical splice donor site probably null
R5102:Cps1 UTSW 1 67206793 missense probably benign 0.00
R5215:Cps1 UTSW 1 67166380 missense possibly damaging 0.62
R5290:Cps1 UTSW 1 67172709 missense probably benign 0.21
R5732:Cps1 UTSW 1 67157764 missense probably benign 0.22
R5818:Cps1 UTSW 1 67166488 missense possibly damaging 0.96
R5878:Cps1 UTSW 1 67157878 critical splice donor site probably null
R6002:Cps1 UTSW 1 67172755 missense possibly damaging 0.94
R6034:Cps1 UTSW 1 67157713 intron probably null
R6034:Cps1 UTSW 1 67157713 intron probably null
R6199:Cps1 UTSW 1 67162615 frame shift probably null
R6310:Cps1 UTSW 1 67142981 missense probably benign 0.00
R6554:Cps1 UTSW 1 67174469 nonsense probably null
R6700:Cps1 UTSW 1 67229523 splice site probably null
R7052:Cps1 UTSW 1 67198410 missense probably damaging 1.00
R7278:Cps1 UTSW 1 67170921 missense probably damaging 1.00
R7313:Cps1 UTSW 1 67198358 missense probably damaging 0.99
R7323:Cps1 UTSW 1 67157869 missense probably benign 0.03
R7339:Cps1 UTSW 1 67197015 missense possibly damaging 0.64
R7485:Cps1 UTSW 1 67139857 missense probably damaging 1.00
R7505:Cps1 UTSW 1 67180081 missense probably benign
R7748:Cps1 UTSW 1 67139806 missense probably damaging 1.00
R7853:Cps1 UTSW 1 67174481 missense possibly damaging 0.92
R7936:Cps1 UTSW 1 67174481 missense possibly damaging 0.92
X0024:Cps1 UTSW 1 67123247 missense probably benign
Z1176:Cps1 UTSW 1 67123268 missense possibly damaging 0.54
Z1176:Cps1 UTSW 1 67148719 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GTTACTGGAGCAAACTCAAAATCC -3'
(R):5'- TGTAAACGCCAATGACTTACCAAG -3'

Sequencing Primer
(F):5'- TGGAGCAAACTCAAAATCCAAACTAC -3'
(R):5'- AATGTTGCTGTTCATTTTTCATAGAC -3'
Posted On2018-08-01