Incidental Mutation 'R6731:Sele'
ID 530043
Institutional Source Beutler Lab
Gene Symbol Sele
Ensembl Gene ENSMUSG00000026582
Gene Name selectin, endothelial cell
Synonyms CD62E, E-selectin, Elam
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock # R6731 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 164048234-164057677 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 164053673 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 481 (L481F)
Ref Sequence ENSEMBL: ENSMUSP00000027874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027874]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000027874
AA Change: L481F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027874
Gene: ENSMUSG00000026582
AA Change: L481F

DomainStartEndE-ValueType
CLECT 21 146 1.45e-21 SMART
EGF 149 182 2.83e-5 SMART
CCP 187 245 1.49e-9 SMART
CCP 250 307 5.43e-12 SMART
CCP 312 370 1.82e-13 SMART
CCP 375 433 1.36e-12 SMART
CCP 438 496 6e-14 SMART
CCP 501 555 1.39e-9 SMART
transmembrane domain 565 587 N/A INTRINSIC
Meta Mutation Damage Score 0.5579 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.3%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in cytokine-stimulated endothelial cells and is thought to be responsible for the accumulation of blood leukocytes at sites of inflammation by mediating the adhesion of cells to the vascular lining. It exhibits structural features such as the presence of lectin- and EGF-like domains followed by short consensus repeat (SCR) domains that contain 6 conserved cysteine residues. These proteins are part of the selectin family of cell adhesion molecules. Adhesion molecules participate in the interaction between leukocytes and the endothelium and appear to be involved in the pathogenesis of atherosclerosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit mild defects in neutrophil infiltration during inflammatory responses. When combined with other selectin gene knockouts, more severe defects are present. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A G 17: 33,066,226 V534A probably benign Het
Acta1 G A 8: 123,893,217 T128I probably damaging Het
Ahnak T A 19: 9,011,562 D3403E possibly damaging Het
Aldoc T A 11: 78,326,092 D319E probably benign Het
Ank3 T A 10: 70,014,028 D1108E possibly damaging Het
Ankrd7 G A 6: 18,866,654 G58S probably damaging Het
Ass1 A T 2: 31,514,784 Y359F probably damaging Het
B3gnt2 G T 11: 22,836,888 S100* probably null Het
Cd46 T C 1: 195,083,467 probably null Het
Chst5 G T 8: 111,890,044 R315S probably benign Het
Cps1 T C 1: 67,160,871 S393P probably damaging Het
Dis3l T C 9: 64,310,438 probably null Het
Fgg T C 3: 83,012,901 F329S probably damaging Het
Hsp90b1 T C 10: 86,701,905 T179A probably benign Het
Kat2a A T 11: 100,708,273 M559K probably damaging Het
Klhl41 T C 2: 69,674,700 I449T probably damaging Het
Lama5 A T 2: 180,188,574 I1880N probably benign Het
Lcp1 A G 14: 75,206,189 D215G probably damaging Het
Lrch3 A G 16: 32,950,420 T131A probably damaging Het
Mroh6 T C 15: 75,888,492 T78A probably benign Het
Naa15 T G 3: 51,455,873 V326G probably damaging Het
Nalcn T A 14: 123,599,934 Q6L probably benign Het
Nipbl T A 15: 8,322,590 I1863L probably damaging Het
Os9 C T 10: 127,098,543 G408D probably benign Het
Pcbp2 T C 15: 102,488,790 S237P probably damaging Het
Pcdhb10 G A 18: 37,413,476 R535H probably benign Het
Pex5l A T 3: 32,958,798 I320K probably damaging Het
Pgm1 T C 5: 64,100,975 F101S probably benign Het
Poc1b T A 10: 99,152,871 D207E probably null Het
Pou6f1 T C 15: 100,579,883 I460V possibly damaging Het
Rnf17 A T 14: 56,524,350 Q1623H possibly damaging Het
Rnf219 C T 14: 104,479,474 V488I probably benign Het
Rpap1 T C 2: 119,778,296 N195S probably benign Het
Sacs C A 14: 61,180,700 probably null Het
Scube2 G A 7: 109,810,737 T643M probably damaging Het
Stk32a A G 18: 43,305,078 Y214C probably damaging Het
Tex44 T A 1: 86,426,485 S39T probably benign Het
Tmem135 A T 7: 89,243,964 M140K possibly damaging Het
Tox2 A G 2: 163,320,377 Y354C probably damaging Het
Trim21 A T 7: 102,559,212 F433L probably damaging Het
Trim24 T C 6: 37,943,485 F406L probably damaging Het
Ubr1 G C 2: 120,955,640 H166Q probably null Het
Wnt16 T A 6: 22,297,892 Y252* probably null Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zfp141 T C 7: 42,489,500 D36G probably damaging Het
Zfp729a C T 13: 67,620,146 V655I probably benign Het
Zfp974 A T 7: 27,911,649 V217E possibly damaging Het
Other mutations in Sele
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Sele APN 1 164051834 missense probably damaging 1.00
IGL02097:Sele APN 1 164053093 missense probably benign 0.02
IGL02243:Sele APN 1 164052968 missense probably benign 0.01
IGL02688:Sele APN 1 164050130 missense probably damaging 1.00
IGL03022:Sele APN 1 164054679 missense probably benign 0.01
R0433:Sele UTSW 1 164049244 missense possibly damaging 0.74
R0487:Sele UTSW 1 164053615 nonsense probably null
R0678:Sele UTSW 1 164054729 critical splice donor site probably null
R1295:Sele UTSW 1 164050810 missense probably damaging 1.00
R1296:Sele UTSW 1 164050810 missense probably damaging 1.00
R1532:Sele UTSW 1 164053851 missense probably benign 0.29
R1730:Sele UTSW 1 164054623 missense probably benign
R2102:Sele UTSW 1 164053826 missense probably damaging 1.00
R2384:Sele UTSW 1 164050775 missense probably benign 0.00
R3001:Sele UTSW 1 164053571 missense probably damaging 1.00
R3002:Sele UTSW 1 164053571 missense probably damaging 1.00
R5851:Sele UTSW 1 164049574 missense probably benign 0.06
R6164:Sele UTSW 1 164051817 splice site probably null
R6239:Sele UTSW 1 164050808 missense probably damaging 0.98
R6406:Sele UTSW 1 164050743 missense probably damaging 1.00
R6411:Sele UTSW 1 164049415 missense probably benign 0.03
R6851:Sele UTSW 1 164053952 missense probably damaging 1.00
R7291:Sele UTSW 1 164053868 missense possibly damaging 0.89
R7328:Sele UTSW 1 164049275 missense probably benign 0.23
R7366:Sele UTSW 1 164048719 missense probably benign 0.00
R7393:Sele UTSW 1 164053923 missense probably benign 0.05
R7431:Sele UTSW 1 164051620 missense probably damaging 0.99
R7603:Sele UTSW 1 164049515 missense probably damaging 1.00
R7803:Sele UTSW 1 164050694 missense possibly damaging 0.88
R7807:Sele UTSW 1 164053893 missense probably benign 0.05
R8323:Sele UTSW 1 164051638 missense possibly damaging 0.59
R9018:Sele UTSW 1 164053679 missense probably damaging 1.00
R9310:Sele UTSW 1 164049406 missense probably benign 0.04
R9630:Sele UTSW 1 164051954 missense probably damaging 0.99
X0005:Sele UTSW 1 164049343 missense probably damaging 1.00
X0021:Sele UTSW 1 164053611 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ATCTTTGTGGCTTGGCTACC -3'
(R):5'- ATGTTCATCTTTCCCGGGAC -3'

Sequencing Primer
(F):5'- TGTGACACCTGCTATAGCCCAATG -3'
(R):5'- ACGTCAAGGCTTGGACATTGTAC -3'
Posted On 2018-08-01