Mutagenetix > Incidental Mutations

Incidental Mutation 'R6731:Ass1'

530045

Institutional Source

Beutler Lab

Gene Symbol

Ass1

Ensembl Gene

ENSMUSG00000076441

Gene Name

argininosuccinate synthetase 1

Synonyms

Ass-1, ASS, fold

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6731 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

31470207-31520672 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 31514784 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 359 (Y359F)

Ref Sequence

ENSEMBL: ENSMUSP00000099904 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102840]

Predicted Effect

probably damaging
Transcript: ENSMUST00000102840
AA Change: Y359F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000099904
Gene: ENSMUSG00000076441
AA Change: Y359F

Domain	Start	End	E-Value	Type
Pfam:QueC	6	93	2.8e-7	PFAM
Pfam:Arginosuc_synth	8	403	1.9e-177	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126474

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130195

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192802

Meta Mutation Damage Score

0.1451

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 95.3%

Validation Efficiency

98% (47/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the penultimate step of the arginine biosynthetic pathway. There are approximately 10 to 14 copies of this gene including the pseudogenes scattered across the human genome, among which the one located on chromosome 9 appears to be the only functional gene for argininosuccinate synthetase. Mutations in the chromosome 9 copy of this gene cause citrullinemia. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2012]
PHENOTYPE: Targeted disruption of this gene results in high levels of blood citrulline, hyperammonemia, and death by 24 hours after birth. Some spontaneous mutations display wrinkled skin, sparse hair with delayed hair appearance and abnormal hair follicle morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	A	G	17: 33,066,226	V534A	probably benign	Het
Acta1	G	A	8: 123,893,217	T128I	probably damaging	Het
Ahnak	T	A	19: 9,011,562	D3403E	possibly damaging	Het
Aldoc	T	A	11: 78,326,092	D319E	probably benign	Het
Ank3	T	A	10: 70,014,028	D1108E	possibly damaging	Het
Ankrd7	G	A	6: 18,866,654	G58S	probably damaging	Het
B3gnt2	G	T	11: 22,836,888	S100*	probably null	Het
Cd46	T	C	1: 195,083,467		probably null	Het
Chst5	G	T	8: 111,890,044	R315S	probably benign	Het
Cps1	T	C	1: 67,160,871	S393P	probably damaging	Het
Dis3l	T	C	9: 64,310,438		probably null	Het
Fgg	T	C	3: 83,012,901	F329S	probably damaging	Het
Hsp90b1	T	C	10: 86,701,905	T179A	probably benign	Het
Kat2a	A	T	11: 100,708,273	M559K	probably damaging	Het
Klhl41	T	C	2: 69,674,700	I449T	probably damaging	Het
Lama5	A	T	2: 180,188,574	I1880N	probably benign	Het
Lcp1	A	G	14: 75,206,189	D215G	probably damaging	Het
Lrch3	A	G	16: 32,950,420	T131A	probably damaging	Het
Mroh6	T	C	15: 75,888,492	T78A	probably benign	Het
Naa15	T	G	3: 51,455,873	V326G	probably damaging	Het
Nalcn	T	A	14: 123,599,934	Q6L	probably benign	Het
Nipbl	T	A	15: 8,322,590	I1863L	probably damaging	Het
Os9	C	T	10: 127,098,543	G408D	probably benign	Het
Pcbp2	T	C	15: 102,488,790	S237P	probably damaging	Het
Pcdhb10	G	A	18: 37,413,476	R535H	probably benign	Het
Pex5l	A	T	3: 32,958,798	I320K	probably damaging	Het
Pgm1	T	C	5: 64,100,975	F101S	probably benign	Het
Poc1b	T	A	10: 99,152,871	D207E	probably null	Het
Pou6f1	T	C	15: 100,579,883	I460V	possibly damaging	Het
Rnf17	A	T	14: 56,524,350	Q1623H	possibly damaging	Het
Rnf219	C	T	14: 104,479,474	V488I	probably benign	Het
Rpap1	T	C	2: 119,778,296	N195S	probably benign	Het
Sacs	C	A	14: 61,180,700		probably null	Het
Scube2	G	A	7: 109,810,737	T643M	probably damaging	Het
Sele	C	T	1: 164,053,673	L481F	probably damaging	Het
Stk32a	A	G	18: 43,305,078	Y214C	probably damaging	Het
Tex44	T	A	1: 86,426,485	S39T	probably benign	Het
Tmem135	A	T	7: 89,243,964	M140K	possibly damaging	Het
Tox2	A	G	2: 163,320,377	Y354C	probably damaging	Het
Trim21	A	T	7: 102,559,212	F433L	probably damaging	Het
Trim24	T	C	6: 37,943,485	F406L	probably damaging	Het
Ubr1	G	C	2: 120,955,640	H166Q	probably null	Het
Wnt16	T	A	6: 22,297,892	Y252*	probably null	Het
Yod1	G	A	1: 130,717,538	G19S	probably damaging	Het
Zfp141	T	C	7: 42,489,500	D36G	probably damaging	Het
Zfp729a	C	T	13: 67,620,146	V655I	probably benign	Het
Zfp974	A	T	7: 27,911,649	V217E	possibly damaging	Het

Other mutations in Ass1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01413:Ass1	APN	2	31476922	missense	probably damaging	1.00
IGL02152:Ass1	APN	2	31492324	missense	probably damaging	1.00
R0008:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0083:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0084:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0085:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0087:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0183:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0220:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0254:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0302:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0346:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0440:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0472:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0605:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0644:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R1460:Ass1	UTSW	2	31514741	missense	probably benign	0.37
R1465:Ass1	UTSW	2	31520416	makesense	probably null
R1465:Ass1	UTSW	2	31520416	makesense	probably null
R1770:Ass1	UTSW	2	31486516	missense	probably benign	0.29
R1908:Ass1	UTSW	2	31493148	nonsense	probably null
R2361:Ass1	UTSW	2	31520382	missense	probably benign	0.02
R2430:Ass1	UTSW	2	31501496	missense	probably damaging	1.00
R3816:Ass1	UTSW	2	31510105	splice site	probably benign
R4614:Ass1	UTSW	2	31514783	missense	probably damaging	1.00
R4628:Ass1	UTSW	2	31480988	missense	probably damaging	1.00
R5007:Ass1	UTSW	2	31501532	missense	possibly damaging	0.90
R5069:Ass1	UTSW	2	31510173	missense	probably damaging	1.00
R5081:Ass1	UTSW	2	31488653	critical splice donor site	probably null
R5315:Ass1	UTSW	2	31492329	missense	probably benign	0.21
R5370:Ass1	UTSW	2	31518733	missense	possibly damaging	0.56
R6259:Ass1	UTSW	2	31488642	missense	possibly damaging	0.80
R6541:Ass1	UTSW	2	31510233	missense	probably damaging	0.99
R6927:Ass1	UTSW	2	31514801	missense	probably damaging	1.00
R7811:Ass1	UTSW	2	31514741	missense	probably benign	0.37
R7995:Ass1	UTSW	2	31486540	missense	not run

Predicted Primers

PCR Primer
(F):5'- GCCTATCAGAAGGTAAGGCC -3'
(R):5'- CACCTGGCTTGTAGGTTCCATG -3'

Sequencing Primer
(F):5'- TAAGGCCTGGGCTCTGCTC -3'
(R):5'- GCTTGTAGGTTCCATGACATTACAG -3'

Posted On

2018-08-01