Mutagenetix > Incidental Mutation

Incidental Mutation 'R6731:Ubr1'

530048

Institutional Source

Beutler Lab

Gene Symbol

Ubr1

Ensembl Gene

ENSMUSG00000027272

Gene Name

ubiquitin protein ligase E3 component n-recognin 1

Synonyms

E3 alpha

MMRRC Submission

044849-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.864) question?

Stock #

R6731 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

120860269-120970715 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 120955640 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 166 (H166Q)

Ref Sequence

ENSEMBL: ENSMUSP00000028728 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028728]

AlphaFold

O70481

Predicted Effect

probably null
Transcript: ENSMUST00000028728
AA Change: H166Q

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000028728
Gene: ENSMUSG00000027272
AA Change: H166Q

Domain	Start	End	E-Value	Type
ZnF_UBR1	97	167	1.24e-35	SMART
Pfam:ClpS	221	301	8e-24	PFAM
low complexity region	918	936	N/A	INTRINSIC
low complexity region	1017	1030	N/A	INTRINSIC
low complexity region	1070	1081	N/A	INTRINSIC
Blast:RING	1101	1203	4e-34	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133408

Meta Mutation Damage Score

0.9756

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 95.3%

Validation Efficiency

98% (47/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The N-end rule pathway is one proteolytic pathway of the ubiquitin system. The recognition component of this pathway, encoded by this gene, binds to a destabilizing N-terminal residue of a substrate protein and participates in the formation of a substrate-linked multiubiquitin chain. This leads to the eventual degradation of the substrate protein. The protein described in this record has a RING-type zinc finger and a UBR-type zinc finger. Mutations in this gene have been associated with Johanson-Blizzard syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have 20% lower body weight and reduced muscle and adipose tissue. Skeletal muscle lacks a mechanism for targeting proteins for rapid catabolism. Aberrant regulation of fatty acid synthase upon starvation is also observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	A	G	17: 33,066,226	V534A	probably benign	Het
Acta1	G	A	8: 123,893,217	T128I	probably damaging	Het
Ahnak	T	A	19: 9,011,562	D3403E	possibly damaging	Het
Aldoc	T	A	11: 78,326,092	D319E	probably benign	Het
Ank3	T	A	10: 70,014,028	D1108E	possibly damaging	Het
Ankrd7	G	A	6: 18,866,654	G58S	probably damaging	Het
Ass1	A	T	2: 31,514,784	Y359F	probably damaging	Het
B3gnt2	G	T	11: 22,836,888	S100*	probably null	Het
Cd46	T	C	1: 195,083,467		probably null	Het
Chst5	G	T	8: 111,890,044	R315S	probably benign	Het
Cps1	T	C	1: 67,160,871	S393P	probably damaging	Het
Dis3l	T	C	9: 64,310,438		probably null	Het
Fgg	T	C	3: 83,012,901	F329S	probably damaging	Het
Hsp90b1	T	C	10: 86,701,905	T179A	probably benign	Het
Kat2a	A	T	11: 100,708,273	M559K	probably damaging	Het
Klhl41	T	C	2: 69,674,700	I449T	probably damaging	Het
Lama5	A	T	2: 180,188,574	I1880N	probably benign	Het
Lcp1	A	G	14: 75,206,189	D215G	probably damaging	Het
Lrch3	A	G	16: 32,950,420	T131A	probably damaging	Het
Mroh6	T	C	15: 75,888,492	T78A	probably benign	Het
Naa15	T	G	3: 51,455,873	V326G	probably damaging	Het
Nalcn	T	A	14: 123,599,934	Q6L	probably benign	Het
Nipbl	T	A	15: 8,322,590	I1863L	probably damaging	Het
Os9	C	T	10: 127,098,543	G408D	probably benign	Het
Pcbp2	T	C	15: 102,488,790	S237P	probably damaging	Het
Pcdhb10	G	A	18: 37,413,476	R535H	probably benign	Het
Pex5l	A	T	3: 32,958,798	I320K	probably damaging	Het
Pgm1	T	C	5: 64,100,975	F101S	probably benign	Het
Poc1b	T	A	10: 99,152,871	D207E	probably null	Het
Pou6f1	T	C	15: 100,579,883	I460V	possibly damaging	Het
Rnf17	A	T	14: 56,524,350	Q1623H	possibly damaging	Het
Rnf219	C	T	14: 104,479,474	V488I	probably benign	Het
Rpap1	T	C	2: 119,778,296	N195S	probably benign	Het
Sacs	C	A	14: 61,180,700		probably null	Het
Scube2	G	A	7: 109,810,737	T643M	probably damaging	Het
Sele	C	T	1: 164,053,673	L481F	probably damaging	Het
Stk32a	A	G	18: 43,305,078	Y214C	probably damaging	Het
Tex44	T	A	1: 86,426,485	S39T	probably benign	Het
Tmem135	A	T	7: 89,243,964	M140K	possibly damaging	Het
Tox2	A	G	2: 163,320,377	Y354C	probably damaging	Het
Trim21	A	T	7: 102,559,212	F433L	probably damaging	Het
Trim24	T	C	6: 37,943,485	F406L	probably damaging	Het
Wnt16	T	A	6: 22,297,892	Y252*	probably null	Het
Yod1	G	A	1: 130,717,538	G19S	probably damaging	Het
Zfp141	T	C	7: 42,489,500	D36G	probably damaging	Het
Zfp729a	C	T	13: 67,620,146	V655I	probably benign	Het
Zfp974	A	T	7: 27,911,649	V217E	possibly damaging	Het

Other mutations in Ubr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00552:Ubr1	APN	2	120875407	missense	possibly damaging	0.65
IGL00570:Ubr1	APN	2	120941093	missense	possibly damaging	0.93
IGL00990:Ubr1	APN	2	120930872	missense	probably damaging	1.00
IGL01124:Ubr1	APN	2	120914905	missense	probably benign
IGL01346:Ubr1	APN	2	120873122	critical splice donor site	probably null
IGL01368:Ubr1	APN	2	120941131	splice site	probably benign
IGL01539:Ubr1	APN	2	120926013	missense	possibly damaging	0.79
IGL01862:Ubr1	APN	2	120934342	missense	possibly damaging	0.81
IGL01965:Ubr1	APN	2	120875398	missense	probably damaging	0.99
IGL01984:Ubr1	APN	2	120921386	missense	probably damaging	0.99
IGL02184:Ubr1	APN	2	120900508	missense	probably benign	0.00
IGL02208:Ubr1	APN	2	120946349	missense	probably benign	0.00
IGL02415:Ubr1	APN	2	120970603	utr 5 prime	probably benign
IGL02517:Ubr1	APN	2	120864373	missense	possibly damaging	0.69
IGL02614:Ubr1	APN	2	120870979	splice site	probably benign
IGL02627:Ubr1	APN	2	120940991	missense	probably damaging	1.00
IGL02718:Ubr1	APN	2	120914883	missense	probably damaging	1.00
IGL02741:Ubr1	APN	2	120941091	missense	probably benign	0.01
IGL02939:Ubr1	APN	2	120881183	critical splice acceptor site	probably null
IGL03081:Ubr1	APN	2	120961156	missense	possibly damaging	0.83
IGL03310:Ubr1	APN	2	120864417	missense	probably damaging	1.00
IGL03370:Ubr1	APN	2	120895160	missense	probably benign
I1329:Ubr1	UTSW	2	120934294	splice site	probably benign
R0022:Ubr1	UTSW	2	120961173	splice site	probably benign
R0345:Ubr1	UTSW	2	120904103	splice site	probably null
R0373:Ubr1	UTSW	2	120946657	missense	probably benign	0.01
R0393:Ubr1	UTSW	2	120906946	missense	probably damaging	1.00
R0543:Ubr1	UTSW	2	120881093	missense	probably damaging	1.00
R0559:Ubr1	UTSW	2	120947883	nonsense	probably null
R0723:Ubr1	UTSW	2	120881101	nonsense	probably null
R1178:Ubr1	UTSW	2	120926029	nonsense	probably null
R1401:Ubr1	UTSW	2	120955644	missense	probably benign	0.01
R1485:Ubr1	UTSW	2	120961098	missense	probably benign	0.03
R1572:Ubr1	UTSW	2	120935319	splice site	probably benign
R1920:Ubr1	UTSW	2	120930968	missense	probably benign	0.11
R1921:Ubr1	UTSW	2	120930968	missense	probably benign	0.11
R1997:Ubr1	UTSW	2	120946273	critical splice donor site	probably null
R2129:Ubr1	UTSW	2	120942553	missense	probably benign	0.35
R2147:Ubr1	UTSW	2	120864330	missense	probably damaging	1.00
R2191:Ubr1	UTSW	2	120926047	missense	probably damaging	0.96
R2288:Ubr1	UTSW	2	120909482	missense	probably damaging	1.00
R3409:Ubr1	UTSW	2	120963448	missense	probably benign	0.02
R3930:Ubr1	UTSW	2	120916470	missense	probably benign	0.20
R3979:Ubr1	UTSW	2	120862687	missense	probably benign	0.11
R4172:Ubr1	UTSW	2	120946622	splice site	probably null
R4173:Ubr1	UTSW	2	120946622	splice site	probably null
R4174:Ubr1	UTSW	2	120946622	splice site	probably null
R4241:Ubr1	UTSW	2	120934386	missense	possibly damaging	0.69
R4366:Ubr1	UTSW	2	120970603	utr 5 prime	probably benign
R4371:Ubr1	UTSW	2	120895066	splice site	probably null
R4449:Ubr1	UTSW	2	120946381	missense	possibly damaging	0.84
R4533:Ubr1	UTSW	2	120942482	missense	possibly damaging	0.86
R4656:Ubr1	UTSW	2	120926013	missense	probably benign	0.35
R4765:Ubr1	UTSW	2	120963442	nonsense	probably null
R4928:Ubr1	UTSW	2	120914938	missense	probably damaging	1.00
R4987:Ubr1	UTSW	2	120963566	missense	probably benign	0.00
R5033:Ubr1	UTSW	2	120911997	critical splice donor site	probably null
R5108:Ubr1	UTSW	2	120963422	missense	probably benign	0.20
R5118:Ubr1	UTSW	2	120882264	missense	probably benign	0.20
R5211:Ubr1	UTSW	2	120893170	missense	possibly damaging	0.92
R5215:Ubr1	UTSW	2	120904044	missense	probably benign	0.00
R5449:Ubr1	UTSW	2	120963500	missense	probably benign
R5452:Ubr1	UTSW	2	120868302	missense	possibly damaging	0.95
R5582:Ubr1	UTSW	2	120915407	missense	probably benign
R5610:Ubr1	UTSW	2	120892112	missense	probably benign	0.04
R5637:Ubr1	UTSW	2	120963517	missense	possibly damaging	0.68
R5808:Ubr1	UTSW	2	120961092	missense	possibly damaging	0.63
R5845:Ubr1	UTSW	2	120904005	missense	probably benign
R5979:Ubr1	UTSW	2	120946382	missense	probably benign	0.07
R6044:Ubr1	UTSW	2	120862721	missense	probably benign	0.38
R6146:Ubr1	UTSW	2	120893209	missense	probably damaging	0.98
R6252:Ubr1	UTSW	2	120906895	missense	probably benign	0.21
R6389:Ubr1	UTSW	2	120881039	missense	probably benign	0.03
R6600:Ubr1	UTSW	2	120915399	missense	probably benign	0.00
R6670:Ubr1	UTSW	2	120924130	critical splice donor site	probably null
R6836:Ubr1	UTSW	2	120896675	splice site	probably null
R6994:Ubr1	UTSW	2	120963593	missense	probably benign
R7121:Ubr1	UTSW	2	120875498	missense	probably benign	0.00
R7204:Ubr1	UTSW	2	120904077	missense	possibly damaging	0.49
R7209:Ubr1	UTSW	2	120862765	missense	probably benign	0.04
R7434:Ubr1	UTSW	2	120862680	missense	probably benign
R7457:Ubr1	UTSW	2	120917828	missense	probably benign	0.35
R7464:Ubr1	UTSW	2	120889774	critical splice donor site	probably null
R7519:Ubr1	UTSW	2	120875444	missense	possibly damaging	0.63
R7574:Ubr1	UTSW	2	120873191	missense	possibly damaging	0.93
R8030:Ubr1	UTSW	2	120934374	missense	probably damaging	0.99
R8085:Ubr1	UTSW	2	120934417	nonsense	probably null
R8221:Ubr1	UTSW	2	120961104	missense	probably damaging	0.97
R8241:Ubr1	UTSW	2	120963456	missense	possibly damaging	0.80
R8291:Ubr1	UTSW	2	120911115	missense	probably benign
R8293:Ubr1	UTSW	2	120862721	missense	probably benign	0.38
R8420:Ubr1	UTSW	2	120870995	missense	probably benign
R8489:Ubr1	UTSW	2	120881067	missense	probably benign	0.42
R8708:Ubr1	UTSW	2	120866483	missense	probably benign	0.27
R8856:Ubr1	UTSW	2	120904042	missense	probably damaging	1.00
R8995:Ubr1	UTSW	2	120866553	missense	probably damaging	1.00
R9153:Ubr1	UTSW	2	120925988	missense	probably benign	0.00
R9155:Ubr1	UTSW	2	120924134	missense	possibly damaging	0.84
R9156:Ubr1	UTSW	2	120873122	critical splice donor site	probably null
R9194:Ubr1	UTSW	2	120947844	missense	probably damaging	1.00
R9320:Ubr1	UTSW	2	120896519	missense	probably benign	0.04
R9401:Ubr1	UTSW	2	120935284	missense	probably benign	0.06
R9430:Ubr1	UTSW	2	120904025	missense	possibly damaging	0.59
R9515:Ubr1	UTSW	2	120873146	missense	probably damaging	1.00
R9623:Ubr1	UTSW	2	120934339	missense	probably benign	0.06
R9703:Ubr1	UTSW	2	120901611	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GATTCTAAGTGGAATCAGTCTTAACCC -3'
(R):5'- TTAAATACAGCCAAGAAGTGCG -3'

Sequencing Primer
(F):5'- GAAGTCAGTATTCTGCTAGCAGCC -3'
(R):5'- AGTGCGAGTGAATACTTTTTATTGC -3'

Posted On

2018-08-01