Incidental Mutation 'R6731:Scube2'
ID 530063
Institutional Source Beutler Lab
Gene Symbol Scube2
Ensembl Gene ENSMUSG00000007279
Gene Name signal peptide, CUB domain, EGF-like 2
Synonyms ICRFP703B1614Q5.1, Cegf1, ICRFP703N2430Q5.1, 4932442O19Rik
MMRRC Submission 044849-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.633) question?
Stock # R6731 (G1)
Quality Score 217.009
Status Validated
Chromosome 7
Chromosomal Location 109397897-109464886 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 109409944 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 643 (T643M)
Ref Sequence ENSEMBL: ENSMUSP00000007423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007423] [ENSMUST00000106728] [ENSMUST00000106729]
AlphaFold Q9JJS0
Predicted Effect probably damaging
Transcript: ENSMUST00000007423
AA Change: T643M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000007423
Gene: ENSMUSG00000007279
AA Change: T643M

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 479 490 N/A INTRINSIC
low complexity region 577 594 N/A INTRINSIC
Pfam:GCC2_GCC3 642 692 7.2e-19 PFAM
Pfam:GCC2_GCC3 699 746 2e-16 PFAM
Pfam:GCC2_GCC3 755 802 3.1e-18 PFAM
CUB 807 919 1.23e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106728
AA Change: T517M

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102339
Gene: ENSMUSG00000007279
AA Change: T517M

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 451 468 N/A INTRINSIC
Pfam:GCC2_GCC3 516 566 6.4e-17 PFAM
Pfam:GCC2_GCC3 573 620 3.5e-14 PFAM
Pfam:GCC2_GCC3 629 676 5.4e-16 PFAM
Blast:CUB 678 727 2e-25 BLAST
Blast:CUB 730 796 1e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106729
SMART Domains Protein: ENSMUSP00000102340
Gene: ENSMUSG00000007279

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 605 622 N/A INTRINSIC
Pfam:GCC2_GCC3 670 717 1.8e-16 PFAM
Pfam:GCC2_GCC3 726 773 2.7e-18 PFAM
CUB 778 890 1.23e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132113
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138946
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.3%
Validation Efficiency 98% (47/48)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are smaller than controls. Mice also exhibit defective endochondral bone formation and impaired Ihh-mediated chondrocyte differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta1 G A 8: 124,619,956 (GRCm39) T128I probably damaging Het
Ahnak T A 19: 8,988,926 (GRCm39) D3403E possibly damaging Het
Aldoc T A 11: 78,216,918 (GRCm39) D319E probably benign Het
Ank3 T A 10: 69,849,858 (GRCm39) D1108E possibly damaging Het
Ankrd7 G A 6: 18,866,653 (GRCm39) G58S probably damaging Het
Ass1 A T 2: 31,404,796 (GRCm39) Y359F probably damaging Het
B3gnt2 G T 11: 22,786,888 (GRCm39) S100* probably null Het
Cd46 T C 1: 194,765,775 (GRCm39) probably null Het
Chst5 G T 8: 112,616,676 (GRCm39) R315S probably benign Het
Cps1 T C 1: 67,200,030 (GRCm39) S393P probably damaging Het
Dis3l T C 9: 64,217,720 (GRCm39) probably null Het
Fgg T C 3: 82,920,208 (GRCm39) F329S probably damaging Het
Hsp90b1 T C 10: 86,537,769 (GRCm39) T179A probably benign Het
Kat2a A T 11: 100,599,099 (GRCm39) M559K probably damaging Het
Klhl41 T C 2: 69,505,044 (GRCm39) I449T probably damaging Het
Lama5 A T 2: 179,830,367 (GRCm39) I1880N probably benign Het
Lcp1 A G 14: 75,443,629 (GRCm39) D215G probably damaging Het
Lrch3 A G 16: 32,770,790 (GRCm39) T131A probably damaging Het
Mroh6 T C 15: 75,760,341 (GRCm39) T78A probably benign Het
Naa15 T G 3: 51,363,294 (GRCm39) V326G probably damaging Het
Nalcn T A 14: 123,837,346 (GRCm39) Q6L probably benign Het
Nipbl T A 15: 8,352,074 (GRCm39) I1863L probably damaging Het
Obi1 C T 14: 104,716,910 (GRCm39) V488I probably benign Het
Os9 C T 10: 126,934,412 (GRCm39) G408D probably benign Het
Pcbp2 T C 15: 102,397,225 (GRCm39) S237P probably damaging Het
Pcdhb10 G A 18: 37,546,529 (GRCm39) R535H probably benign Het
Pex5l A T 3: 33,012,947 (GRCm39) I320K probably damaging Het
Pgm2 T C 5: 64,258,318 (GRCm39) F101S probably benign Het
Phf8-ps A G 17: 33,285,200 (GRCm39) V534A probably benign Het
Poc1b T A 10: 98,988,733 (GRCm39) D207E probably null Het
Pou6f1 T C 15: 100,477,764 (GRCm39) I460V possibly damaging Het
Rnf17 A T 14: 56,761,807 (GRCm39) Q1623H possibly damaging Het
Rpap1 T C 2: 119,608,777 (GRCm39) N195S probably benign Het
Sacs C A 14: 61,418,149 (GRCm39) probably null Het
Sele C T 1: 163,881,242 (GRCm39) L481F probably damaging Het
Stk32a A G 18: 43,438,143 (GRCm39) Y214C probably damaging Het
Tex44 T A 1: 86,354,207 (GRCm39) S39T probably benign Het
Tmem135 A T 7: 88,893,172 (GRCm39) M140K possibly damaging Het
Tox2 A G 2: 163,162,297 (GRCm39) Y354C probably damaging Het
Trim21 A T 7: 102,208,419 (GRCm39) F433L probably damaging Het
Trim24 T C 6: 37,920,420 (GRCm39) F406L probably damaging Het
Ubr1 G C 2: 120,786,121 (GRCm39) H166Q probably null Het
Wnt16 T A 6: 22,297,891 (GRCm39) Y252* probably null Het
Yod1 G A 1: 130,645,275 (GRCm39) G19S probably damaging Het
Zfp141 T C 7: 42,138,924 (GRCm39) D36G probably damaging Het
Zfp729a C T 13: 67,768,265 (GRCm39) V655I probably benign Het
Zfp974 A T 7: 27,611,074 (GRCm39) V217E possibly damaging Het
Other mutations in Scube2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Scube2 APN 7 109,407,661 (GRCm39) missense probably damaging 1.00
IGL01608:Scube2 APN 7 109,442,461 (GRCm39) missense probably benign
IGL02080:Scube2 APN 7 109,451,685 (GRCm39) missense probably damaging 1.00
PIT4445001:Scube2 UTSW 7 109,408,387 (GRCm39) missense probably benign 0.22
R0020:Scube2 UTSW 7 109,430,095 (GRCm39) splice site probably benign
R0020:Scube2 UTSW 7 109,430,095 (GRCm39) splice site probably benign
R0106:Scube2 UTSW 7 109,446,115 (GRCm39) splice site probably benign
R0230:Scube2 UTSW 7 109,423,971 (GRCm39) critical splice donor site probably null
R0255:Scube2 UTSW 7 109,424,079 (GRCm39) missense probably damaging 0.98
R0427:Scube2 UTSW 7 109,424,044 (GRCm39) missense probably benign 0.00
R0612:Scube2 UTSW 7 109,403,971 (GRCm39) splice site probably benign
R0658:Scube2 UTSW 7 109,436,327 (GRCm39) splice site probably benign
R0687:Scube2 UTSW 7 109,428,335 (GRCm39) missense possibly damaging 0.47
R1087:Scube2 UTSW 7 109,430,882 (GRCm39) missense probably damaging 1.00
R1366:Scube2 UTSW 7 109,403,821 (GRCm39) missense probably damaging 1.00
R1635:Scube2 UTSW 7 109,442,421 (GRCm39) missense possibly damaging 0.90
R1797:Scube2 UTSW 7 109,430,882 (GRCm39) missense probably damaging 1.00
R1972:Scube2 UTSW 7 109,408,421 (GRCm39) missense probably benign 0.16
R2080:Scube2 UTSW 7 109,407,712 (GRCm39) missense possibly damaging 0.77
R2254:Scube2 UTSW 7 109,424,666 (GRCm39) missense possibly damaging 0.47
R2315:Scube2 UTSW 7 109,403,908 (GRCm39) missense probably damaging 1.00
R2325:Scube2 UTSW 7 109,443,161 (GRCm39) missense probably damaging 1.00
R3723:Scube2 UTSW 7 109,407,613 (GRCm39) splice site probably benign
R3887:Scube2 UTSW 7 109,442,383 (GRCm39) splice site probably benign
R3946:Scube2 UTSW 7 109,456,797 (GRCm39) missense possibly damaging 0.81
R4030:Scube2 UTSW 7 109,430,978 (GRCm39) missense probably benign 0.09
R4621:Scube2 UTSW 7 109,399,857 (GRCm39) missense possibly damaging 0.63
R4684:Scube2 UTSW 7 109,409,920 (GRCm39) missense probably damaging 0.96
R4736:Scube2 UTSW 7 109,430,412 (GRCm39) missense probably benign 0.01
R5096:Scube2 UTSW 7 109,398,451 (GRCm39) utr 3 prime probably benign
R5266:Scube2 UTSW 7 109,408,437 (GRCm39) missense probably damaging 1.00
R5579:Scube2 UTSW 7 109,409,944 (GRCm39) missense probably damaging 1.00
R5669:Scube2 UTSW 7 109,424,646 (GRCm39) missense probably benign 0.04
R5838:Scube2 UTSW 7 109,407,651 (GRCm39) missense probably damaging 1.00
R5916:Scube2 UTSW 7 109,430,931 (GRCm39) missense possibly damaging 0.77
R6056:Scube2 UTSW 7 109,432,220 (GRCm39) nonsense probably null
R6785:Scube2 UTSW 7 109,409,824 (GRCm39) missense probably benign
R8197:Scube2 UTSW 7 109,407,684 (GRCm39) missense possibly damaging 0.53
R8250:Scube2 UTSW 7 109,463,377 (GRCm39) missense probably benign 0.20
R8273:Scube2 UTSW 7 109,408,383 (GRCm39) missense probably benign 0.00
R8427:Scube2 UTSW 7 109,399,797 (GRCm39) missense probably damaging 1.00
R8882:Scube2 UTSW 7 109,451,680 (GRCm39) missense probably damaging 1.00
R9258:Scube2 UTSW 7 109,398,515 (GRCm39) missense probably damaging 1.00
R9428:Scube2 UTSW 7 109,428,345 (GRCm39) missense probably benign 0.32
R9476:Scube2 UTSW 7 109,430,969 (GRCm39) missense probably damaging 1.00
R9510:Scube2 UTSW 7 109,430,969 (GRCm39) missense probably damaging 1.00
R9709:Scube2 UTSW 7 109,430,971 (GRCm39) missense probably damaging 1.00
Z1177:Scube2 UTSW 7 109,442,408 (GRCm39) missense probably damaging 1.00
Z1177:Scube2 UTSW 7 109,437,334 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAACGACACTGGGGACTG -3'
(R):5'- ACTTATTAGTCAGGGGCAATAGG -3'

Sequencing Primer
(F):5'- GAGTAAGAAGGGACACACAGAATCC -3'
(R):5'- TTATTAGTCAGGGGCAATAGGAGTAG -3'
Posted On 2018-08-01