Incidental Mutation 'R6731:Kat2a'
ID 530073
Institutional Source Beutler Lab
Gene Symbol Kat2a
Ensembl Gene ENSMUSG00000020918
Gene Name K(lysine) acetyltransferase 2A
Synonyms Gcn5, PCAF-B/GCN5, 1110051E14Rik, Gcn5l2
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6731 (G1)
Quality Score 202.009
Status Validated
Chromosome 11
Chromosomal Location 100704746-100712465 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 100708273 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 559 (M559K)
Ref Sequence ENSEMBL: ENSMUSP00000006973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006973] [ENSMUST00000017974] [ENSMUST00000103118]
AlphaFold Q9JHD2
Predicted Effect probably damaging
Transcript: ENSMUST00000006973
AA Change: M559K

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000006973
Gene: ENSMUSG00000020918
AA Change: M559K

DomainStartEndE-ValueType
low complexity region 21 72 N/A INTRINSIC
Pfam:PCAF_N 81 332 1.2e-155 PFAM
low complexity region 398 417 N/A INTRINSIC
Pfam:Acetyltransf_7 538 621 5e-13 PFAM
Pfam:Acetyltransf_1 545 620 3.2e-11 PFAM
low complexity region 659 675 N/A INTRINSIC
BROMO 718 826 6.87e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000017974
SMART Domains Protein: ENSMUSP00000017974
Gene: ENSMUSG00000017830

DomainStartEndE-ValueType
DEXDc 2 207 2.86e-22 SMART
HELICc 387 475 3.85e-14 SMART
Blast:HELICc 497 543 4e-12 BLAST
Pfam:RIG-I_C-RD 552 667 1.5e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103118
AA Change: M560K

PolyPhen 2 Score 0.231 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099407
Gene: ENSMUSG00000020918
AA Change: M560K

DomainStartEndE-ValueType
low complexity region 21 72 N/A INTRINSIC
Pfam:PCAF_N 81 331 4.4e-120 PFAM
low complexity region 398 417 N/A INTRINSIC
Pfam:Acetyltransf_7 539 622 1.2e-11 PFAM
Pfam:Acetyltransf_1 547 621 3.1e-11 PFAM
low complexity region 660 676 N/A INTRINSIC
BROMO 719 827 6.87e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126167
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153526
Meta Mutation Damage Score 0.7008 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.3%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] KAT2A, or GCN5, is a histone acetyltransferase (HAT) that functions primarily as a transcriptional activator. It also functions as a repressor of NF-kappa-B (see MIM 164011) by promoting ubiquitination of the NF-kappa-B subunit RELA (MIM 164014) in a HAT-independent manner (Mao et al., 2009 [PubMed 19339690]).[supplied by OMIM, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit poorly developed yolk sac blood vessels, retarded growth, absence of dorsal mesoderm lineages, failure to form somites, and lethality between embryonic days 9.5-11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A G 17: 33,066,226 V534A probably benign Het
Acta1 G A 8: 123,893,217 T128I probably damaging Het
Ahnak T A 19: 9,011,562 D3403E possibly damaging Het
Aldoc T A 11: 78,326,092 D319E probably benign Het
Ank3 T A 10: 70,014,028 D1108E possibly damaging Het
Ankrd7 G A 6: 18,866,654 G58S probably damaging Het
Ass1 A T 2: 31,514,784 Y359F probably damaging Het
B3gnt2 G T 11: 22,836,888 S100* probably null Het
Cd46 T C 1: 195,083,467 probably null Het
Chst5 G T 8: 111,890,044 R315S probably benign Het
Cps1 T C 1: 67,160,871 S393P probably damaging Het
Dis3l T C 9: 64,310,438 probably null Het
Fgg T C 3: 83,012,901 F329S probably damaging Het
Hsp90b1 T C 10: 86,701,905 T179A probably benign Het
Klhl41 T C 2: 69,674,700 I449T probably damaging Het
Lama5 A T 2: 180,188,574 I1880N probably benign Het
Lcp1 A G 14: 75,206,189 D215G probably damaging Het
Lrch3 A G 16: 32,950,420 T131A probably damaging Het
Mroh6 T C 15: 75,888,492 T78A probably benign Het
Naa15 T G 3: 51,455,873 V326G probably damaging Het
Nalcn T A 14: 123,599,934 Q6L probably benign Het
Nipbl T A 15: 8,322,590 I1863L probably damaging Het
Os9 C T 10: 127,098,543 G408D probably benign Het
Pcbp2 T C 15: 102,488,790 S237P probably damaging Het
Pcdhb10 G A 18: 37,413,476 R535H probably benign Het
Pex5l A T 3: 32,958,798 I320K probably damaging Het
Pgm1 T C 5: 64,100,975 F101S probably benign Het
Poc1b T A 10: 99,152,871 D207E probably null Het
Pou6f1 T C 15: 100,579,883 I460V possibly damaging Het
Rnf17 A T 14: 56,524,350 Q1623H possibly damaging Het
Rnf219 C T 14: 104,479,474 V488I probably benign Het
Rpap1 T C 2: 119,778,296 N195S probably benign Het
Sacs C A 14: 61,180,700 probably null Het
Scube2 G A 7: 109,810,737 T643M probably damaging Het
Sele C T 1: 164,053,673 L481F probably damaging Het
Stk32a A G 18: 43,305,078 Y214C probably damaging Het
Tex44 T A 1: 86,426,485 S39T probably benign Het
Tmem135 A T 7: 89,243,964 M140K possibly damaging Het
Tox2 A G 2: 163,320,377 Y354C probably damaging Het
Trim21 A T 7: 102,559,212 F433L probably damaging Het
Trim24 T C 6: 37,943,485 F406L probably damaging Het
Ubr1 G C 2: 120,955,640 H166Q probably null Het
Wnt16 T A 6: 22,297,892 Y252* probably null Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zfp141 T C 7: 42,489,500 D36G probably damaging Het
Zfp729a C T 13: 67,620,146 V655I probably benign Het
Zfp974 A T 7: 27,911,649 V217E possibly damaging Het
Other mutations in Kat2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Kat2a APN 11 100705384 missense probably damaging 1.00
IGL00476:Kat2a APN 11 100705384 missense probably damaging 1.00
IGL00952:Kat2a APN 11 100706151 missense probably damaging 0.98
IGL01529:Kat2a APN 11 100711909 missense probably damaging 1.00
IGL02424:Kat2a APN 11 100711147 splice site probably null
IGL03338:Kat2a APN 11 100711475 missense probably benign 0.30
R0096:Kat2a UTSW 11 100706471 missense probably damaging 1.00
R0711:Kat2a UTSW 11 100706471 missense probably damaging 1.00
R0714:Kat2a UTSW 11 100711352 missense probably damaging 0.99
R0784:Kat2a UTSW 11 100710841 missense probably benign 0.05
R1652:Kat2a UTSW 11 100708611 missense probably damaging 0.98
R2152:Kat2a UTSW 11 100712346 unclassified probably benign
R2177:Kat2a UTSW 11 100710822 missense probably damaging 1.00
R2510:Kat2a UTSW 11 100712142 missense probably benign 0.32
R2570:Kat2a UTSW 11 100710822 missense probably damaging 1.00
R4175:Kat2a UTSW 11 100705266 missense probably damaging 1.00
R4965:Kat2a UTSW 11 100712203 unclassified probably benign
R4965:Kat2a UTSW 11 100712204 unclassified probably benign
R5316:Kat2a UTSW 11 100712170 missense possibly damaging 0.77
R5732:Kat2a UTSW 11 100708240 missense probably damaging 1.00
R5954:Kat2a UTSW 11 100708898 missense possibly damaging 0.89
R6618:Kat2a UTSW 11 100712370 unclassified probably benign
R6719:Kat2a UTSW 11 100712141 missense probably benign 0.00
R7291:Kat2a UTSW 11 100710900 missense possibly damaging 0.55
R7373:Kat2a UTSW 11 100708566 missense probably benign 0.00
R7632:Kat2a UTSW 11 100708596 nonsense probably null
R8305:Kat2a UTSW 11 100709478 missense possibly damaging 0.77
R8322:Kat2a UTSW 11 100712290 missense unknown
R8729:Kat2a UTSW 11 100710511 missense probably benign 0.10
R9381:Kat2a UTSW 11 100711866 missense possibly damaging 0.50
R9432:Kat2a UTSW 11 100711352 missense probably damaging 0.99
R9472:Kat2a UTSW 11 100705371 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGTGGAAATGTCTGGTCGCTAC -3'
(R):5'- GACGCTCTCTTAATAACAGGGC -3'

Sequencing Primer
(F):5'- TGTCTGGTCGCTACAAGAAG -3'
(R):5'- TTAATAACAGGGCTCCACCTTTCAGG -3'
Posted On 2018-08-01