Mutagenetix > Incidental Mutation

Incidental Mutation 'R6731:Lcp1'

530076

Institutional Source

Beutler Lab

Gene Symbol

Lcp1

Ensembl Gene

ENSMUSG00000021998

Gene Name

lymphocyte cytosolic protein 1

Synonyms

D14Ertd310e, L-fimbrin, Pls2, L-plastin

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6731 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

75131101-75230842 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 75206189 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 215 (D215G)

Ref Sequence

ENSEMBL: ENSMUSP00000116271 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000124499] [ENSMUST00000131802] [ENSMUST00000145303]

AlphaFold

Q61233

Predicted Effect

probably damaging
Transcript: ENSMUST00000124499
AA Change: D215G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000121201
Gene: ENSMUSG00000021998
AA Change: D215G

Domain	Start	End	E-Value	Type
EFh	13	41	6.91e-5	SMART
EFh	53	81	7.7e-3	SMART
CH	122	234	1.15e-24	SMART
CH	266	373	1.51e-19	SMART
CH	396	501	1.87e-24	SMART
CH	517	622	8.55e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000131802
AA Change: D215G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000117137
Gene: ENSMUSG00000021998
AA Change: D215G

Domain	Start	End	E-Value	Type
EFh	13	41	6.91e-5	SMART
EFh	53	81	7.7e-3	SMART
CH	122	234	1.15e-24	SMART
CH	266	373	1.51e-19	SMART
CH	396	501	1.87e-24	SMART
CH	517	622	8.55e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000145303
AA Change: D215G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000116271
Gene: ENSMUSG00000021998
AA Change: D215G

Domain	Start	End	E-Value	Type
EFh	13	41	6.91e-5	SMART
EFh	53	81	7.7e-3	SMART
CH	122	234	1.15e-24	SMART
CH	266	373	1.51e-19	SMART
CH	396	501	1.87e-24	SMART
CH	517	622	8.55e-19	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 95.3%

Validation Efficiency

98% (47/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. Plastin 1 (otherwise known as Fimbrin) is a third distinct plastin isoform which is specifically expressed at high levels in the small intestine. The L isoform is expressed only in hemopoietic cell lineages, while the T isoform has been found in all other normal cells of solid tissues that have replicative potential (fibroblasts, endothelial cells, epithelial cells, melanocytes, etc.). However, L-plastin has been found in many types of malignant human cells of non-hemopoietic origin suggesting that its expression is induced accompanying tumorigenesis in solid tissues. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to S. aureus infection, defective neutrophil killing of S. aureus, and impaired adhesion-dependent respiratory bursts in neutrophils. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	A	G	17: 33,066,226	V534A	probably benign	Het
Acta1	G	A	8: 123,893,217	T128I	probably damaging	Het
Ahnak	T	A	19: 9,011,562	D3403E	possibly damaging	Het
Aldoc	T	A	11: 78,326,092	D319E	probably benign	Het
Ank3	T	A	10: 70,014,028	D1108E	possibly damaging	Het
Ankrd7	G	A	6: 18,866,654	G58S	probably damaging	Het
Ass1	A	T	2: 31,514,784	Y359F	probably damaging	Het
B3gnt2	G	T	11: 22,836,888	S100*	probably null	Het
Cd46	T	C	1: 195,083,467		probably null	Het
Chst5	G	T	8: 111,890,044	R315S	probably benign	Het
Cps1	T	C	1: 67,160,871	S393P	probably damaging	Het
Dis3l	T	C	9: 64,310,438		probably null	Het
Fgg	T	C	3: 83,012,901	F329S	probably damaging	Het
Hsp90b1	T	C	10: 86,701,905	T179A	probably benign	Het
Kat2a	A	T	11: 100,708,273	M559K	probably damaging	Het
Klhl41	T	C	2: 69,674,700	I449T	probably damaging	Het
Lama5	A	T	2: 180,188,574	I1880N	probably benign	Het
Lrch3	A	G	16: 32,950,420	T131A	probably damaging	Het
Mroh6	T	C	15: 75,888,492	T78A	probably benign	Het
Naa15	T	G	3: 51,455,873	V326G	probably damaging	Het
Nalcn	T	A	14: 123,599,934	Q6L	probably benign	Het
Nipbl	T	A	15: 8,322,590	I1863L	probably damaging	Het
Os9	C	T	10: 127,098,543	G408D	probably benign	Het
Pcbp2	T	C	15: 102,488,790	S237P	probably damaging	Het
Pcdhb10	G	A	18: 37,413,476	R535H	probably benign	Het
Pex5l	A	T	3: 32,958,798	I320K	probably damaging	Het
Pgm1	T	C	5: 64,100,975	F101S	probably benign	Het
Poc1b	T	A	10: 99,152,871	D207E	probably null	Het
Pou6f1	T	C	15: 100,579,883	I460V	possibly damaging	Het
Rnf17	A	T	14: 56,524,350	Q1623H	possibly damaging	Het
Rnf219	C	T	14: 104,479,474	V488I	probably benign	Het
Rpap1	T	C	2: 119,778,296	N195S	probably benign	Het
Sacs	C	A	14: 61,180,700		probably null	Het
Scube2	G	A	7: 109,810,737	T643M	probably damaging	Het
Sele	C	T	1: 164,053,673	L481F	probably damaging	Het
Stk32a	A	G	18: 43,305,078	Y214C	probably damaging	Het
Tex44	T	A	1: 86,426,485	S39T	probably benign	Het
Tmem135	A	T	7: 89,243,964	M140K	possibly damaging	Het
Tox2	A	G	2: 163,320,377	Y354C	probably damaging	Het
Trim21	A	T	7: 102,559,212	F433L	probably damaging	Het
Trim24	T	C	6: 37,943,485	F406L	probably damaging	Het
Ubr1	G	C	2: 120,955,640	H166Q	probably null	Het
Wnt16	T	A	6: 22,297,892	Y252*	probably null	Het
Yod1	G	A	1: 130,717,538	G19S	probably damaging	Het
Zfp141	T	C	7: 42,489,500	D36G	probably damaging	Het
Zfp729a	C	T	13: 67,620,146	V655I	probably benign	Het
Zfp974	A	T	7: 27,911,649	V217E	possibly damaging	Het

Other mutations in Lcp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01103:Lcp1	APN	14	75227093	critical splice donor site	probably null
IGL01768:Lcp1	APN	14	75224133	missense	probably benign	0.40
IGL01801:Lcp1	APN	14	75199375	missense	probably benign	0.10
IGL01940:Lcp1	APN	14	75216365	missense	probably benign	0.17
IGL02135:Lcp1	APN	14	75200486	missense	probably benign	0.00
IGL02185:Lcp1	APN	14	75229300	missense	possibly damaging	0.73
IGL02478:Lcp1	APN	14	75224096	missense	probably benign	0.04
IGL02604:Lcp1	APN	14	75224126	missense	probably benign	0.11
R0244:Lcp1	UTSW	14	75227001	missense	possibly damaging	0.92
R0295:Lcp1	UTSW	14	75199420	missense	probably null	0.59
R0313:Lcp1	UTSW	14	75199433	missense	probably damaging	1.00
R0415:Lcp1	UTSW	14	75227006	missense	possibly damaging	0.88
R0751:Lcp1	UTSW	14	75199387	missense	probably benign	0.00
R0811:Lcp1	UTSW	14	75214488	missense	probably benign	0.00
R0812:Lcp1	UTSW	14	75214488	missense	probably benign	0.00
R1200:Lcp1	UTSW	14	75229302	missense	possibly damaging	0.73
R1713:Lcp1	UTSW	14	75199444	critical splice donor site	probably null
R1915:Lcp1	UTSW	14	75199297	missense	possibly damaging	0.81
R1969:Lcp1	UTSW	14	75200506	missense	probably damaging	1.00
R1970:Lcp1	UTSW	14	75200506	missense	probably damaging	1.00
R1971:Lcp1	UTSW	14	75200506	missense	probably damaging	1.00
R2045:Lcp1	UTSW	14	75200401	missense	probably benign	0.01
R2064:Lcp1	UTSW	14	75198075	critical splice acceptor site	probably null
R3949:Lcp1	UTSW	14	75206129	missense	possibly damaging	0.68
R4062:Lcp1	UTSW	14	75215180	missense	probably damaging	1.00
R4521:Lcp1	UTSW	14	75215168	missense	possibly damaging	0.94
R4811:Lcp1	UTSW	14	75200408	missense	probably damaging	0.99
R4854:Lcp1	UTSW	14	75200489	missense	probably damaging	1.00
R4974:Lcp1	UTSW	14	75208471	nonsense	probably null
R5539:Lcp1	UTSW	14	75229298	missense	probably benign	0.08
R5561:Lcp1	UTSW	14	75212508	missense	probably benign	0.01
R5724:Lcp1	UTSW	14	75226982	missense	probably benign	0.18
R5989:Lcp1	UTSW	14	75199387	missense	probably benign	0.00
R7346:Lcp1	UTSW	14	75210506	missense	possibly damaging	0.49
R7670:Lcp1	UTSW	14	75200431	missense	probably benign	0.12
R7698:Lcp1	UTSW	14	75206211	nonsense	probably null
R9780:Lcp1	UTSW	14	75202738	missense	probably damaging	1.00
S24628:Lcp1	UTSW	14	75227006	missense	possibly damaging	0.88
X0027:Lcp1	UTSW	14	75227086	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAGATCTTGCCTCTGGGTC -3'
(R):5'- AAAGCCTTTGCGTTGTCATC -3'

Sequencing Primer
(F):5'- GTCTGTAACCATTCCAGAAGGAC -3'
(R):5'- CAGCTGGAGAATGCCTAATGTCTTC -3'

Posted On

2018-08-01