Incidental Mutation 'R6731:Rnf219'
ID530077
Institutional Source Beutler Lab
Gene Symbol Rnf219
Ensembl Gene ENSMUSG00000022120
Gene Namering finger protein 219
Synonyms2810449K13Rik, 2610206B13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R6731 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location104477536-104522645 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 104479474 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 488 (V488I)
Ref Sequence ENSEMBL: ENSMUSP00000022716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022716]
Predicted Effect probably benign
Transcript: ENSMUST00000022716
AA Change: V488I

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000022716
Gene: ENSMUSG00000022120
AA Change: V488I

DomainStartEndE-ValueType
RING 18 55 2.78e-3 SMART
coiled coil region 87 129 N/A INTRINSIC
coiled coil region 157 263 N/A INTRINSIC
low complexity region 302 319 N/A INTRINSIC
low complexity region 647 658 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226423
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.3%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A G 17: 33,066,226 V534A probably benign Het
Acta1 G A 8: 123,893,217 T128I probably damaging Het
Ahnak T A 19: 9,011,562 D3403E possibly damaging Het
Aldoc T A 11: 78,326,092 D319E probably benign Het
Ank3 T A 10: 70,014,028 D1108E possibly damaging Het
Ankrd7 G A 6: 18,866,654 G58S probably damaging Het
Ass1 A T 2: 31,514,784 Y359F probably damaging Het
B3gnt2 G T 11: 22,836,888 S100* probably null Het
Cd46 T C 1: 195,083,467 probably null Het
Chst5 G T 8: 111,890,044 R315S probably benign Het
Cps1 T C 1: 67,160,871 S393P probably damaging Het
Dis3l T C 9: 64,310,438 probably null Het
Fgg T C 3: 83,012,901 F329S probably damaging Het
Hsp90b1 T C 10: 86,701,905 T179A probably benign Het
Kat2a A T 11: 100,708,273 M559K probably damaging Het
Klhl41 T C 2: 69,674,700 I449T probably damaging Het
Lama5 A T 2: 180,188,574 I1880N probably benign Het
Lcp1 A G 14: 75,206,189 D215G probably damaging Het
Lrch3 A G 16: 32,950,420 T131A probably damaging Het
Mroh6 T C 15: 75,888,492 T78A probably benign Het
Naa15 T G 3: 51,455,873 V326G probably damaging Het
Nalcn T A 14: 123,599,934 Q6L probably benign Het
Nipbl T A 15: 8,322,590 I1863L probably damaging Het
Os9 C T 10: 127,098,543 G408D probably benign Het
Pcbp2 T C 15: 102,488,790 S237P probably damaging Het
Pcdhb10 G A 18: 37,413,476 R535H probably benign Het
Pex5l A T 3: 32,958,798 I320K probably damaging Het
Pgm1 T C 5: 64,100,975 F101S probably benign Het
Poc1b T A 10: 99,152,871 D207E probably null Het
Pou6f1 T C 15: 100,579,883 I460V possibly damaging Het
Rnf17 A T 14: 56,524,350 Q1623H possibly damaging Het
Rpap1 T C 2: 119,778,296 N195S probably benign Het
Sacs C A 14: 61,180,700 probably null Het
Scube2 G A 7: 109,810,737 T643M probably damaging Het
Sele C T 1: 164,053,673 L481F probably damaging Het
Stk32a A G 18: 43,305,078 Y214C probably damaging Het
Tex44 T A 1: 86,426,485 S39T probably benign Het
Tmem135 A T 7: 89,243,964 M140K possibly damaging Het
Tox2 A G 2: 163,320,377 Y354C probably damaging Het
Trim21 A T 7: 102,559,212 F433L probably damaging Het
Trim24 T C 6: 37,943,485 F406L probably damaging Het
Ubr1 G C 2: 120,955,640 H166Q probably null Het
Wnt16 T A 6: 22,297,892 Y252* probably null Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zfp141 T C 7: 42,489,500 D36G probably damaging Het
Zfp729a C T 13: 67,620,146 V655I probably benign Het
Zfp974 A T 7: 27,911,649 V217E possibly damaging Het
Other mutations in Rnf219
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01727:Rnf219 APN 14 104479387 nonsense probably null
IGL01731:Rnf219 APN 14 104479302 missense probably damaging 1.00
I2505:Rnf219 UTSW 14 104503449 splice site probably benign
IGL03098:Rnf219 UTSW 14 104478817 missense possibly damaging 0.93
PIT4651001:Rnf219 UTSW 14 104506256 missense probably damaging 0.99
R0047:Rnf219 UTSW 14 104503344 splice site probably null
R0047:Rnf219 UTSW 14 104503344 splice site probably null
R0394:Rnf219 UTSW 14 104478853 missense possibly damaging 0.74
R0608:Rnf219 UTSW 14 104479527 missense probably damaging 1.00
R0727:Rnf219 UTSW 14 104480188 missense probably damaging 1.00
R1109:Rnf219 UTSW 14 104479764 nonsense probably null
R1774:Rnf219 UTSW 14 104479662 missense possibly damaging 0.68
R1922:Rnf219 UTSW 14 104479186 missense probably benign 0.02
R2018:Rnf219 UTSW 14 104522542 missense probably damaging 1.00
R2061:Rnf219 UTSW 14 104522532 splice site probably benign
R2182:Rnf219 UTSW 14 104506176 missense possibly damaging 0.55
R2336:Rnf219 UTSW 14 104478882 missense probably damaging 1.00
R4308:Rnf219 UTSW 14 104479593 missense probably damaging 0.97
R4355:Rnf219 UTSW 14 104479257 missense probably benign 0.01
R4703:Rnf219 UTSW 14 104506208 missense probably benign 0.03
R4738:Rnf219 UTSW 14 104510383 missense probably damaging 1.00
R4739:Rnf219 UTSW 14 104510383 missense probably damaging 1.00
R4869:Rnf219 UTSW 14 104478816 missense probably damaging 0.99
R5025:Rnf219 UTSW 14 104508030 missense probably damaging 1.00
R5054:Rnf219 UTSW 14 104508030 missense probably damaging 1.00
R5167:Rnf219 UTSW 14 104478787 missense probably damaging 1.00
R6356:Rnf219 UTSW 14 104478877 missense probably damaging 0.99
R6427:Rnf219 UTSW 14 104480226 missense possibly damaging 0.70
R6482:Rnf219 UTSW 14 104479817 nonsense probably null
R6518:Rnf219 UTSW 14 104479065 missense probably damaging 1.00
R6619:Rnf219 UTSW 14 104522557 missense possibly damaging 0.88
R6754:Rnf219 UTSW 14 104503414 missense probably damaging 1.00
R6812:Rnf219 UTSW 14 104510432 missense unknown
R7225:Rnf219 UTSW 14 104479858 missense probably benign 0.00
R7567:Rnf219 UTSW 14 104479378 missense probably damaging 1.00
X0002:Rnf219 UTSW 14 104507977 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGACTCTGACATCATGGAGTC -3'
(R):5'- CCTGTGATCAAAGCAGGGAG -3'

Sequencing Primer
(F):5'- TGACATCATGGAGTCCAGCTCAG -3'
(R):5'- CCATCTCAGAAAACTGGTCTTTG -3'
Posted On2018-08-01