Incidental Mutation 'R6732:Smyd3'
ID530091
Institutional Source Beutler Lab
Gene Symbol Smyd3
Ensembl Gene ENSMUSG00000055067
Gene NameSET and MYND domain containing 3
Synonyms2410008A19Rik, Zmynd1
MMRRC Submission
Accession Numbers

Genbank: NM_027188; MGI: 1916976; Ensembl: ENSMUST00000128302, ENSMUST00000111134, ENSMUST00000111133

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6732 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location178951960-179518041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 179395830 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 178 (H178P)
Ref Sequence ENSEMBL: ENSMUSP00000106764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111134] [ENSMUST00000128302]
Predicted Effect probably benign
Transcript: ENSMUST00000111134
AA Change: H178P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000106764
Gene: ENSMUSG00000055067
AA Change: H178P

DomainStartEndE-ValueType
Pfam:zf-MYND 40 87 2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125756
Predicted Effect probably benign
Transcript: ENSMUST00000128302
SMART Domains Protein: ENSMUSP00000117410
Gene: ENSMUSG00000055067

DomainStartEndE-ValueType
SET 4 246 1.04e-11 SMART
low complexity region 410 420 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a histone methyltransferase which functions in RNA polymerase II complexes by an interaction with a specific RNA helicase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: No abnormal phenotype was observed in a high-throughput screen, nor in a pathology assessment. [provided by MGI curators]
Allele List at MGI

All alleles(34) : Targeted, other(5) Gene trapped(29)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,810,820 probably null Het
Abcb11 A G 2: 69,286,846 I486T probably damaging Het
Abcc5 T C 16: 20,404,684 N158S probably benign Het
AI182371 G T 2: 35,084,705 probably benign Het
Ap1ar G A 3: 127,815,685 Q96* probably null Het
Cd101 C T 3: 101,008,199 S684N probably benign Het
Cdh16 T G 8: 104,618,533 I375L probably benign Het
Chchd6 A G 6: 89,574,454 V75A probably benign Het
Coro2a A T 4: 46,551,374 N110K probably damaging Het
Cyp2c69 A G 19: 39,881,499 V93A probably benign Het
Egln3 C T 12: 54,180,641 A235T probably benign Het
Fryl T C 5: 73,054,781 T2335A probably damaging Het
Fzd3 T C 14: 65,235,803 D172G probably benign Het
Galnt2 T A 8: 124,340,822 W447R probably damaging Het
Iqce A G 5: 140,675,235 L450P probably benign Het
Ly9 T C 1: 171,594,085 T533A possibly damaging Het
Map3k19 A C 1: 127,824,232 F257V probably benign Het
Mroh7 GTT GTTT 4: 106,680,713 probably null Het
Olfr202 A T 16: 59,283,951 V182E probably benign Het
Pcdhb11 A T 18: 37,422,144 I176F probably benign Het
Pigp A C 16: 94,365,441 L96R probably damaging Het
Pkd1 A G 17: 24,569,413 D715G probably damaging Het
Plxnd1 A C 6: 115,969,929 L828R possibly damaging Het
Pramef20 C T 4: 144,373,173 V341I probably benign Het
Psmd2 T A 16: 20,662,636 S814T probably benign Het
Pusl1 A G 4: 155,891,116 S87P probably benign Het
Rgs3 T A 4: 62,602,943 D34E probably benign Het
Rhof A G 5: 123,131,936 F53L probably damaging Het
Sik3 C A 9: 46,212,553 P1217T probably benign Het
Skiv2l G A 17: 34,845,190 R507* probably null Het
Slc14a2 A G 18: 78,192,174 Y263H probably damaging Het
Slc26a4 C T 12: 31,526,600 probably null Het
Thada T C 17: 84,454,414 probably null Het
Top1mt A C 15: 75,669,488 probably null Het
Trim17 A T 11: 58,971,025 probably null Het
Ttn A T 2: 76,940,051 F2599I possibly damaging Het
Tuba3a A T 6: 125,281,645 D127E probably benign Het
Ucp1 A G 8: 83,291,477 T68A probably benign Het
Vmn2r69 A G 7: 85,411,143 V411A probably benign Het
Vmn2r74 A T 7: 85,957,550 V196E probably damaging Het
Wdr59 T C 8: 111,501,052 Y131C probably damaging Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zbtb21 G T 16: 97,951,082 S667Y probably damaging Het
Other mutations in Smyd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02044:Smyd3 APN 1 178972279 missense probably benign
IGL03088:Smyd3 APN 1 179094333 critical splice donor site probably null
D3080:Smyd3 UTSW 1 179086422 missense probably damaging 1.00
R0165:Smyd3 UTSW 1 179043872 missense probably benign
R0230:Smyd3 UTSW 1 179423428 splice site probably benign
R0390:Smyd3 UTSW 1 178957573 splice site probably benign
R1651:Smyd3 UTSW 1 179043876 missense probably benign
R4651:Smyd3 UTSW 1 179043741 missense probably benign 0.08
R4771:Smyd3 UTSW 1 179094396 missense probably damaging 0.99
R5326:Smyd3 UTSW 1 179410459 missense probably benign
R5542:Smyd3 UTSW 1 179410459 missense probably benign
R5697:Smyd3 UTSW 1 179411682 missense probably damaging 1.00
R5850:Smyd3 UTSW 1 179043855 missense probably damaging 1.00
R7782:Smyd3 UTSW 1 178972294 missense possibly damaging 0.94
R8065:Smyd3 UTSW 1 179410463 missense possibly damaging 0.60
R8067:Smyd3 UTSW 1 179410463 missense possibly damaging 0.60
R8236:Smyd3 UTSW 1 179405640 splice site probably null
R8735:Smyd3 UTSW 1 179092917 missense probably benign 0.12
X0024:Smyd3 UTSW 1 179050289 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCAGCGGGCAGTTCCTTAAC -3'
(R):5'- AGGTGTAAGTCCAAGTCTTCACTC -3'

Sequencing Primer
(F):5'- CCTTAACTAGTTGGCATCAAGGAGC -3'
(R):5'- TGTAAGTCCAAGTCTTCACTCAAACC -3'
Posted On2018-08-01