Incidental Mutation 'R6732:AI182371'
ID530092
Institutional Source Beutler Lab
Gene Symbol AI182371
Ensembl Gene ENSMUSG00000035875
Gene Nameexpressed sequence AI182371
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_178885; MGI: 2138853

Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6732 (G1)
Quality Score110.008
Status Validated
Chromosome2
Chromosomal Location35081861-35101543 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 35084705 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045776] [ENSMUST00000134940] [ENSMUST00000226375] [ENSMUST00000226631] [ENSMUST00000226972]
Predicted Effect unknown
Transcript: ENSMUST00000045776
AA Change: H345N
SMART Domains Protein: ENSMUSP00000037754
Gene: ENSMUSG00000035875
AA Change: H345N

DomainStartEndE-ValueType
Pfam:A2M_N 133 227 4.7e-19 PFAM
ANATO 284 318 1.97e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134940
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154817
Predicted Effect probably benign
Transcript: ENSMUST00000226375
Predicted Effect probably benign
Transcript: ENSMUST00000226631
Predicted Effect probably benign
Transcript: ENSMUST00000226972
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 98% (43/44)
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,810,820 probably null Het
Abcb11 A G 2: 69,286,846 I486T probably damaging Het
Abcc5 T C 16: 20,404,684 N158S probably benign Het
Ap1ar G A 3: 127,815,685 Q96* probably null Het
Cd101 C T 3: 101,008,199 S684N probably benign Het
Cdh16 T G 8: 104,618,533 I375L probably benign Het
Chchd6 A G 6: 89,574,454 V75A probably benign Het
Coro2a A T 4: 46,551,374 N110K probably damaging Het
Cyp2c69 A G 19: 39,881,499 V93A probably benign Het
Egln3 C T 12: 54,180,641 A235T probably benign Het
Fryl T C 5: 73,054,781 T2335A probably damaging Het
Fzd3 T C 14: 65,235,803 D172G probably benign Het
Galnt2 T A 8: 124,340,822 W447R probably damaging Het
Iqce A G 5: 140,675,235 L450P probably benign Het
Ly9 T C 1: 171,594,085 T533A possibly damaging Het
Map3k19 A C 1: 127,824,232 F257V probably benign Het
Mroh7 GTT GTTT 4: 106,680,713 probably null Het
Olfr202 A T 16: 59,283,951 V182E probably benign Het
Pcdhb11 A T 18: 37,422,144 I176F probably benign Het
Pigp A C 16: 94,365,441 L96R probably damaging Het
Pkd1 A G 17: 24,569,413 D715G probably damaging Het
Plxnd1 A C 6: 115,969,929 L828R possibly damaging Het
Pramef20 C T 4: 144,373,173 V341I probably benign Het
Psmd2 T A 16: 20,662,636 S814T probably benign Het
Pusl1 A G 4: 155,891,116 S87P probably benign Het
Rgs3 T A 4: 62,602,943 D34E probably benign Het
Rhof A G 5: 123,131,936 F53L probably damaging Het
Sik3 C A 9: 46,212,553 P1217T probably benign Het
Skiv2l G A 17: 34,845,190 R507* probably null Het
Slc14a2 A G 18: 78,192,174 Y263H probably damaging Het
Slc26a4 C T 12: 31,526,600 probably null Het
Smyd3 T G 1: 179,395,830 H178P probably benign Het
Thada T C 17: 84,454,414 probably null Het
Top1mt A C 15: 75,669,488 probably null Het
Trim17 A T 11: 58,971,025 probably null Het
Ttn A T 2: 76,940,051 F2599I possibly damaging Het
Tuba3a A T 6: 125,281,645 D127E probably benign Het
Ucp1 A G 8: 83,291,477 T68A probably benign Het
Vmn2r69 A G 7: 85,411,143 V411A probably benign Het
Vmn2r74 A T 7: 85,957,550 V196E probably damaging Het
Wdr59 T C 8: 111,501,052 Y131C probably damaging Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zbtb21 G T 16: 97,951,082 S667Y probably damaging Het
Other mutations in AI182371
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02338:AI182371 APN 2 35085716 missense probably benign 0.02
IGL02344:AI182371 APN 2 35089186 missense probably benign 0.01
IGL02817:AI182371 APN 2 35100649 missense probably damaging 0.99
IGL02961:AI182371 APN 2 35086112 missense possibly damaging 0.53
3-1:AI182371 UTSW 2 35100607 missense probably damaging 0.99
R0041:AI182371 UTSW 2 35085721 missense possibly damaging 0.79
R0084:AI182371 UTSW 2 35085702 critical splice donor site probably null
R0472:AI182371 UTSW 2 35085206 missense probably benign 0.35
R1539:AI182371 UTSW 2 35088803 missense probably damaging 0.98
R1634:AI182371 UTSW 2 35086485 missense probably damaging 1.00
R1635:AI182371 UTSW 2 35088737 splice site probably null
R1898:AI182371 UTSW 2 35100649 missense probably damaging 0.99
R2065:AI182371 UTSW 2 35086429 critical splice donor site probably null
R2155:AI182371 UTSW 2 35085354 missense probably benign 0.00
R3694:AI182371 UTSW 2 35085752 missense probably benign 0.00
R3900:AI182371 UTSW 2 35085216 missense probably benign 0.01
R4766:AI182371 UTSW 2 35095817 missense possibly damaging 0.78
R5071:AI182371 UTSW 2 35085215 missense probably benign 0.17
R5500:AI182371 UTSW 2 35100638 missense probably damaging 0.99
R5907:AI182371 UTSW 2 35086122 missense possibly damaging 0.66
R6146:AI182371 UTSW 2 35097971 missense probably damaging 1.00
R6333:AI182371 UTSW 2 35085269 missense probably damaging 0.99
R6729:AI182371 UTSW 2 35084705 intron probably benign
R6742:AI182371 UTSW 2 35084705 intron probably benign
R6781:AI182371 UTSW 2 35084705 intron probably benign
R7196:AI182371 UTSW 2 35086429 critical splice donor site probably null
R7381:AI182371 UTSW 2 35085359 missense probably damaging 1.00
R7458:AI182371 UTSW 2 35086504 missense possibly damaging 0.95
R7466:AI182371 UTSW 2 35088741 nonsense probably null
RF009:AI182371 UTSW 2 35089197 missense possibly damaging 0.90
Z1177:AI182371 UTSW 2 35095759 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGCTGCCTATGGTTTCCTGG -3'
(R):5'- AAGCACATCCATCTGTCAAGTC -3'

Sequencing Primer
(F):5'- CCTTGACTCTGGACAGGTG -3'
(R):5'- CATCCATCTGTCAAGTCACTGTAAG -3'
Posted On2018-08-01