Incidental Mutation 'R6732:Chchd6'
ID 530106
Institutional Source Beutler Lab
Gene Symbol Chchd6
Ensembl Gene ENSMUSG00000030086
Gene Name coiled-coil-helix-coiled-coil-helix domain containing 6
Synonyms 1700021B03Rik, 0710001P09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock # R6732 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 89383146-89595652 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 89574454 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 75 (V75A)
Ref Sequence ENSEMBL: ENSMUSP00000109179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032172] [ENSMUST00000113550]
AlphaFold Q91VN4
Predicted Effect probably benign
Transcript: ENSMUST00000032172
AA Change: V75A

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000032172
Gene: ENSMUSG00000030086
AA Change: V75A

DomainStartEndE-ValueType
Pfam:DUF737 16 227 1.5e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113550
AA Change: V75A

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000109179
Gene: ENSMUSG00000030086
AA Change: V75A

DomainStartEndE-ValueType
Pfam:DUF737 16 179 4.8e-47 PFAM
Pfam:DUF737 173 199 9.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204654
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204970
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,810,820 probably null Het
Abcb11 A G 2: 69,286,846 I486T probably damaging Het
Abcc5 T C 16: 20,404,684 N158S probably benign Het
AI182371 G T 2: 35,084,705 probably benign Het
Ap1ar G A 3: 127,815,685 Q96* probably null Het
Cd101 C T 3: 101,008,199 S684N probably benign Het
Cdh16 T G 8: 104,618,533 I375L probably benign Het
Coro2a A T 4: 46,551,374 N110K probably damaging Het
Cyp2c69 A G 19: 39,881,499 V93A probably benign Het
Egln3 C T 12: 54,180,641 A235T probably benign Het
Fryl T C 5: 73,054,781 T2335A probably damaging Het
Fzd3 T C 14: 65,235,803 D172G probably benign Het
Galnt2 T A 8: 124,340,822 W447R probably damaging Het
Iqce A G 5: 140,675,235 L450P probably benign Het
Ly9 T C 1: 171,594,085 T533A possibly damaging Het
Map3k19 A C 1: 127,824,232 F257V probably benign Het
Mroh7 GTT GTTT 4: 106,680,713 probably null Het
Olfr202 A T 16: 59,283,951 V182E probably benign Het
Pcdhb11 A T 18: 37,422,144 I176F probably benign Het
Pigp A C 16: 94,365,441 L96R probably damaging Het
Pkd1 A G 17: 24,569,413 D715G probably damaging Het
Plxnd1 A C 6: 115,969,929 L828R possibly damaging Het
Pramef20 C T 4: 144,373,173 V341I probably benign Het
Psmd2 T A 16: 20,662,636 S814T probably benign Het
Pusl1 A G 4: 155,891,116 S87P probably benign Het
Rgs3 T A 4: 62,602,943 D34E probably benign Het
Rhof A G 5: 123,131,936 F53L probably damaging Het
Sik3 C A 9: 46,212,553 P1217T probably benign Het
Skiv2l G A 17: 34,845,190 R507* probably null Het
Slc14a2 A G 18: 78,192,174 Y263H probably damaging Het
Slc26a4 C T 12: 31,526,600 probably null Het
Smyd3 T G 1: 179,395,830 H178P probably benign Het
Thada T C 17: 84,454,414 probably null Het
Top1mt A C 15: 75,669,488 probably null Het
Trim17 A T 11: 58,971,025 probably null Het
Ttn A T 2: 76,940,051 F2599I possibly damaging Het
Tuba3a A T 6: 125,281,645 D127E probably benign Het
Ucp1 A G 8: 83,291,477 T68A probably benign Het
Vmn2r69 A G 7: 85,411,143 V411A probably benign Het
Vmn2r74 A T 7: 85,957,550 V196E probably damaging Het
Wdr59 T C 8: 111,501,052 Y131C probably damaging Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zbtb21 G T 16: 97,951,082 S667Y probably damaging Het
Other mutations in Chchd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Chchd6 APN 6 89569417 splice site probably null
IGL02340:Chchd6 APN 6 89419780 missense probably damaging 0.99
IGL02490:Chchd6 APN 6 89384674 missense possibly damaging 0.90
R0557:Chchd6 UTSW 6 89574587 missense probably damaging 1.00
R1170:Chchd6 UTSW 6 89384687 missense probably damaging 1.00
R1341:Chchd6 UTSW 6 89384641 missense probably benign 0.00
R1619:Chchd6 UTSW 6 89419754 missense possibly damaging 0.95
R1757:Chchd6 UTSW 6 89384644 missense probably damaging 1.00
R3886:Chchd6 UTSW 6 89467451 missense probably damaging 1.00
R4627:Chchd6 UTSW 6 89384660 missense probably damaging 1.00
R4635:Chchd6 UTSW 6 89467466 missense probably damaging 1.00
R5518:Chchd6 UTSW 6 89567585 critical splice donor site probably null
R6869:Chchd6 UTSW 6 89595496 missense probably damaging 1.00
R8673:Chchd6 UTSW 6 89569398 missense probably damaging 0.98
R9365:Chchd6 UTSW 6 89574431 missense probably benign 0.25
R9502:Chchd6 UTSW 6 89419781 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTACTGTCTCTGAAAGCAGTG -3'
(R):5'- GCTGGTCTTCAGAAAACCTCAG -3'

Sequencing Primer
(F):5'- TCTCTGAAAGCAGTGACTCAC -3'
(R):5'- CTTCAGAAAACCTCAGTAGTTCTGGG -3'
Posted On 2018-08-01