Incidental Mutation 'R6732:Galnt2'
ID 530114
Institutional Source Beutler Lab
Gene Symbol Galnt2
Ensembl Gene ENSMUSG00000089704
Gene Name polypeptide N-acetylgalactosaminyltransferase 2
Synonyms ppGaNTase-T2
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_139272.2; MGI:894694
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock # R6732 (G1)
Quality Score 220.009
Status Validated
Chromosome 8
Chromosomal Location 124231391-124345724 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 124340822 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 447 (W447R)
Ref Sequence ENSEMBL: ENSMUSP00000118564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034458] [ENSMUST00000127664]
AlphaFold Q6PB93
Predicted Effect probably damaging
Transcript: ENSMUST00000034458
AA Change: W481R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034458
Gene: ENSMUSG00000089704
AA Change: W481R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 25 39 N/A INTRINSIC
Pfam:Glycos_transf_2 138 321 8.3e-31 PFAM
Pfam:Glyco_transf_7C 295 365 5.4e-8 PFAM
RICIN 440 565 9.28e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127664
AA Change: W447R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329
AA Change: W447R

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147911
Meta Mutation Damage Score 0.9547 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycosyltransferase 2 protein family. Members of this family initiate mucin-type O-glycoslation of peptides in the Golgi apparatus. The encoded protein may be involved in O-linked glycosylation of the immunoglobulin A1 hinge region. This gene may influence triglyceride levels, and may be involved Type 2 diabetes, as well as several types of cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
Allele List at MGI

None
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,810,820 probably null Het
Abcb11 A G 2: 69,286,846 I486T probably damaging Het
Abcc5 T C 16: 20,404,684 N158S probably benign Het
AI182371 G T 2: 35,084,705 probably benign Het
Ap1ar G A 3: 127,815,685 Q96* probably null Het
Cd101 C T 3: 101,008,199 S684N probably benign Het
Cdh16 T G 8: 104,618,533 I375L probably benign Het
Chchd6 A G 6: 89,574,454 V75A probably benign Het
Coro2a A T 4: 46,551,374 N110K probably damaging Het
Cyp2c69 A G 19: 39,881,499 V93A probably benign Het
Egln3 C T 12: 54,180,641 A235T probably benign Het
Fryl T C 5: 73,054,781 T2335A probably damaging Het
Fzd3 T C 14: 65,235,803 D172G probably benign Het
Iqce A G 5: 140,675,235 L450P probably benign Het
Ly9 T C 1: 171,594,085 T533A possibly damaging Het
Map3k19 A C 1: 127,824,232 F257V probably benign Het
Mroh7 GTT GTTT 4: 106,680,713 probably null Het
Olfr202 A T 16: 59,283,951 V182E probably benign Het
Pcdhb11 A T 18: 37,422,144 I176F probably benign Het
Pigp A C 16: 94,365,441 L96R probably damaging Het
Pkd1 A G 17: 24,569,413 D715G probably damaging Het
Plxnd1 A C 6: 115,969,929 L828R possibly damaging Het
Pramef20 C T 4: 144,373,173 V341I probably benign Het
Psmd2 T A 16: 20,662,636 S814T probably benign Het
Pusl1 A G 4: 155,891,116 S87P probably benign Het
Rgs3 T A 4: 62,602,943 D34E probably benign Het
Rhof A G 5: 123,131,936 F53L probably damaging Het
Sik3 C A 9: 46,212,553 P1217T probably benign Het
Skiv2l G A 17: 34,845,190 R507* probably null Het
Slc14a2 A G 18: 78,192,174 Y263H probably damaging Het
Slc26a4 C T 12: 31,526,600 probably null Het
Smyd3 T G 1: 179,395,830 H178P probably benign Het
Thada T C 17: 84,454,414 probably null Het
Top1mt A C 15: 75,669,488 probably null Het
Trim17 A T 11: 58,971,025 probably null Het
Ttn A T 2: 76,940,051 F2599I possibly damaging Het
Tuba3a A T 6: 125,281,645 D127E probably benign Het
Ucp1 A G 8: 83,291,477 T68A probably benign Het
Vmn2r69 A G 7: 85,411,143 V411A probably benign Het
Vmn2r74 A T 7: 85,957,550 V196E probably damaging Het
Wdr59 T C 8: 111,501,052 Y131C probably damaging Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zbtb21 G T 16: 97,951,082 S667Y probably damaging Het
Other mutations in Galnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02187:Galnt2 APN 8 124305506 splice site probably benign
IGL02638:Galnt2 APN 8 124231579 missense probably damaging 0.98
chivalry UTSW 8 124334286 nonsense probably null
feudal UTSW 8 124332098 critical splice donor site probably null
gallantry UTSW 8 124340822 missense probably damaging 1.00
valor UTSW 8 124329788 missense probably damaging 1.00
P0018:Galnt2 UTSW 8 124336611 missense probably damaging 1.00
R0133:Galnt2 UTSW 8 124338538 missense probably benign 0.19
R0453:Galnt2 UTSW 8 124338584 splice site probably benign
R0709:Galnt2 UTSW 8 124343346 missense probably benign 0.01
R1015:Galnt2 UTSW 8 124336617 missense probably benign
R4388:Galnt2 UTSW 8 124295453 critical splice donor site probably null
R4400:Galnt2 UTSW 8 124324303 missense probably damaging 1.00
R4447:Galnt2 UTSW 8 124295377 missense probably benign 0.04
R4448:Galnt2 UTSW 8 124295377 missense probably benign 0.04
R4449:Galnt2 UTSW 8 124295377 missense probably benign 0.04
R4450:Galnt2 UTSW 8 124295377 missense probably benign 0.04
R4927:Galnt2 UTSW 8 124305623 missense probably damaging 1.00
R5536:Galnt2 UTSW 8 124323673 missense probably damaging 1.00
R6218:Galnt2 UTSW 8 124343315 missense probably benign 0.01
R6795:Galnt2 UTSW 8 124343436 missense probably damaging 1.00
R6823:Galnt2 UTSW 8 124324011 missense probably benign
R7173:Galnt2 UTSW 8 124305553 missense probably benign 0.00
R7479:Galnt2 UTSW 8 124334338 missense probably damaging 1.00
R7818:Galnt2 UTSW 8 124329788 missense probably damaging 1.00
R7821:Galnt2 UTSW 8 124343395 missense possibly damaging 0.51
R7831:Galnt2 UTSW 8 124332078 missense probably benign 0.04
R8348:Galnt2 UTSW 8 124334286 nonsense probably null
R8770:Galnt2 UTSW 8 124334286 nonsense probably null
R8826:Galnt2 UTSW 8 124305608 missense probably damaging 1.00
R9054:Galnt2 UTSW 8 124332098 critical splice donor site probably null
R9269:Galnt2 UTSW 8 124338463 missense probably benign 0.02
X0024:Galnt2 UTSW 8 124343345 missense probably benign 0.28
Z1177:Galnt2 UTSW 8 124343318 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- AGAACAGACCTACCAGCTGG -3'
(R):5'- GATGAACTGGACCATGGGTGTG -3'

Sequencing Primer
(F):5'- TACCAGCTGGGGCCCAC -3'
(R):5'- TGTGAGGTGGCTAAGCACG -3'
Posted On 2018-08-01