Mutagenetix > Incidental Mutations

Incidental Mutation 'R6732:Galnt2'

530114

Institutional Source

Beutler Lab

Gene Symbol

Galnt2

Ensembl Gene

ENSMUSG00000089704

Gene Name

polypeptide N-acetylgalactosaminyltransferase 2

Synonyms

ppGaNTase-T2

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_139272.2; MGI:894694

Is this an essential gene?

Probably non essential (E-score: 0.114) question?

Stock #

R6732 (G1)

Quality Score

220.009

Status

Validated

Chromosome

Chromosomal Location

124231391-124345724 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 124340822 bp

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 447 (W447R)

Ref Sequence

ENSEMBL: ENSMUSP00000118564 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034458] [ENSMUST00000127664]

Predicted Effect

probably damaging
Transcript: ENSMUST00000034458
AA Change: W481R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034458
Gene: ENSMUSG00000089704
AA Change: W481R

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	25	39	N/A	INTRINSIC
Pfam:Glycos_transf_2	138	321	8.3e-31	PFAM
Pfam:Glyco_transf_7C	295	365	5.4e-8	PFAM
RICIN	440	565	9.28e-27	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000127664
AA Change: W447R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329
AA Change: W447R

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147911

Meta Mutation Damage Score

0.9547

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.5%

Validation Efficiency

98% (43/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycosyltransferase 2 protein family. Members of this family initiate mucin-type O-glycoslation of peptides in the Golgi apparatus. The encoded protein may be involved in O-linked glycosylation of the immunoglobulin A1 hinge region. This gene may influence triglyceride levels, and may be involved Type 2 diabetes, as well as several types of cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]

Allele List at MGI

None

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	A	G	2: 130,810,820		probably null	Het
Abcb11	A	G	2: 69,286,846	I486T	probably damaging	Het
Abcc5	T	C	16: 20,404,684	N158S	probably benign	Het
AI182371	G	T	2: 35,084,705		probably benign	Het
Ap1ar	G	A	3: 127,815,685	Q96*	probably null	Het
Cd101	C	T	3: 101,008,199	S684N	probably benign	Het
Cdh16	T	G	8: 104,618,533	I375L	probably benign	Het
Chchd6	A	G	6: 89,574,454	V75A	probably benign	Het
Coro2a	A	T	4: 46,551,374	N110K	probably damaging	Het
Cyp2c69	A	G	19: 39,881,499	V93A	probably benign	Het
Egln3	C	T	12: 54,180,641	A235T	probably benign	Het
Fryl	T	C	5: 73,054,781	T2335A	probably damaging	Het
Fzd3	T	C	14: 65,235,803	D172G	probably benign	Het
Iqce	A	G	5: 140,675,235	L450P	probably benign	Het
Ly9	T	C	1: 171,594,085	T533A	possibly damaging	Het
Map3k19	A	C	1: 127,824,232	F257V	probably benign	Het
Mroh7	GTT	GTTT	4: 106,680,713		probably null	Het
Olfr202	A	T	16: 59,283,951	V182E	probably benign	Het
Pcdhb11	A	T	18: 37,422,144	I176F	probably benign	Het
Pigp	A	C	16: 94,365,441	L96R	probably damaging	Het
Pkd1	A	G	17: 24,569,413	D715G	probably damaging	Het
Plxnd1	A	C	6: 115,969,929	L828R	possibly damaging	Het
Pramef20	C	T	4: 144,373,173	V341I	probably benign	Het
Psmd2	T	A	16: 20,662,636	S814T	probably benign	Het
Pusl1	A	G	4: 155,891,116	S87P	probably benign	Het
Rgs3	T	A	4: 62,602,943	D34E	probably benign	Het
Rhof	A	G	5: 123,131,936	F53L	probably damaging	Het
Sik3	C	A	9: 46,212,553	P1217T	probably benign	Het
Skiv2l	G	A	17: 34,845,190	R507*	probably null	Het
Slc14a2	A	G	18: 78,192,174	Y263H	probably damaging	Het
Slc26a4	C	T	12: 31,526,600		probably null	Het
Smyd3	T	G	1: 179,395,830	H178P	probably benign	Het
Thada	T	C	17: 84,454,414		probably null	Het
Top1mt	A	C	15: 75,669,488		probably null	Het
Trim17	A	T	11: 58,971,025		probably null	Het
Ttn	A	T	2: 76,940,051	F2599I	possibly damaging	Het
Tuba3a	A	T	6: 125,281,645	D127E	probably benign	Het
Ucp1	A	G	8: 83,291,477	T68A	probably benign	Het
Vmn2r69	A	G	7: 85,411,143	V411A	probably benign	Het
Vmn2r74	A	T	7: 85,957,550	V196E	probably damaging	Het
Wdr59	T	C	8: 111,501,052	Y131C	probably damaging	Het
Yod1	G	A	1: 130,717,538	G19S	probably damaging	Het
Zbtb21	G	T	16: 97,951,082	S667Y	probably damaging	Het

Other mutations in Galnt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02187:Galnt2	APN	8	124305506	splice site	probably benign
IGL02638:Galnt2	APN	8	124231579	missense	probably damaging	0.98
chivalry	UTSW	8	124334286	nonsense	probably null
gallantry	UTSW	8	124340822	missense	probably damaging	1.00
valor	UTSW	8	124329788	missense	probably damaging	1.00
P0018:Galnt2	UTSW	8	124336611	missense	probably damaging	1.00
R0133:Galnt2	UTSW	8	124338538	missense	probably benign	0.19
R0453:Galnt2	UTSW	8	124338584	splice site	probably benign
R0709:Galnt2	UTSW	8	124343346	missense	probably benign	0.01
R1015:Galnt2	UTSW	8	124336617	missense	probably benign
R4388:Galnt2	UTSW	8	124295453	critical splice donor site	probably null
R4400:Galnt2	UTSW	8	124324303	missense	probably damaging	1.00
R4447:Galnt2	UTSW	8	124295377	missense	probably benign	0.04
R4448:Galnt2	UTSW	8	124295377	missense	probably benign	0.04
R4449:Galnt2	UTSW	8	124295377	missense	probably benign	0.04
R4450:Galnt2	UTSW	8	124295377	missense	probably benign	0.04
R4927:Galnt2	UTSW	8	124305623	missense	probably damaging	1.00
R5536:Galnt2	UTSW	8	124323673	missense	probably damaging	1.00
R6218:Galnt2	UTSW	8	124343315	missense	probably benign	0.01
R6795:Galnt2	UTSW	8	124343436	missense	probably damaging	1.00
R6823:Galnt2	UTSW	8	124324011	missense	probably benign
R7173:Galnt2	UTSW	8	124305553	missense	probably benign	0.00
R7479:Galnt2	UTSW	8	124334338	missense	probably damaging	1.00
R7818:Galnt2	UTSW	8	124329788	missense	probably damaging	1.00
R7821:Galnt2	UTSW	8	124343395	missense	possibly damaging	0.51
R7831:Galnt2	UTSW	8	124332078	missense	probably benign	0.04
R8348:Galnt2	UTSW	8	124334286	nonsense	probably null
R8770:Galnt2	UTSW	8	124334286	nonsense	probably null
R8826:Galnt2	UTSW	8	124305608	missense	probably damaging	1.00
X0024:Galnt2	UTSW	8	124343345	missense	probably benign	0.28
Z1177:Galnt2	UTSW	8	124343318	missense	probably benign	0.24

Predicted Primers

PCR Primer
(F):5'- AGAACAGACCTACCAGCTGG -3'
(R):5'- GATGAACTGGACCATGGGTGTG -3'

Sequencing Primer
(F):5'- TACCAGCTGGGGCCCAC -3'
(R):5'- TGTGAGGTGGCTAAGCACG -3'

Posted On

2018-08-01