Incidental Mutation 'R6732:Pigp'
ID530124
Institutional Source Beutler Lab
Gene Symbol Pigp
Ensembl Gene ENSMUSG00000022940
Gene Namephosphatidylinositol glycan anchor biosynthesis, class P
SynonymsDcrc, Dscr5
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.547) question?
Stock #R6732 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location94358763-94371842 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 94365441 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 96 (L96R)
Ref Sequence ENSEMBL: ENSMUSP00000109550 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113905] [ENSMUST00000113906] [ENSMUST00000113910] [ENSMUST00000113914] [ENSMUST00000113917] [ENSMUST00000138514] [ENSMUST00000232294]
Predicted Effect possibly damaging
Transcript: ENSMUST00000113905
AA Change: L63R

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109538
Gene: ENSMUSG00000022940
AA Change: L63R

DomainStartEndE-ValueType
Pfam:PIG-P 10 125 7.6e-45 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113906
AA Change: L63R

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109539
Gene: ENSMUSG00000022940
AA Change: L63R

DomainStartEndE-ValueType
Pfam:PIG-P 10 125 7.6e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113910
AA Change: L92R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109543
Gene: ENSMUSG00000022940
AA Change: L92R

DomainStartEndE-ValueType
Pfam:PIG-P 39 154 1.5e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113914
AA Change: L136R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109547
Gene: ENSMUSG00000022940
AA Change: L136R

DomainStartEndE-ValueType
low complexity region 11 19 N/A INTRINSIC
Pfam:PIG-P 84 197 1e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113917
AA Change: L96R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109550
Gene: ENSMUSG00000022940
AA Change: L96R

DomainStartEndE-ValueType
Pfam:PIG-P 43 135 5.6e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000138514
AA Change: L96R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114477
Gene: ENSMUSG00000022940
AA Change: L96R

DomainStartEndE-ValueType
Pfam:PIG-P 43 152 1.2e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146924
Predicted Effect possibly damaging
Transcript: ENSMUST00000232294
AA Change: L63R

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
Meta Mutation Damage Score 0.8467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme involved in the first step of glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid found on many blood cells that serves to anchor proteins to the cell surface. The encoded protein is a component of the GPI-N-acetylglucosaminyltransferase complex that catalyzes the transfer of N-acetylglucosamine (GlcNAc) from UDP-GlcNAc to phosphatidylinositol (PI). This gene is located in the Down Syndrome critical region on chromosome 21 and is a candidate for the pathogenesis of Down syndrome. This gene has multiple pseudogenes and is a member of the phosphatidylinositol glycan anchor biosynthesis gene family. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,810,820 probably null Het
Abcb11 A G 2: 69,286,846 I486T probably damaging Het
Abcc5 T C 16: 20,404,684 N158S probably benign Het
AI182371 G T 2: 35,084,705 probably benign Het
Ap1ar G A 3: 127,815,685 Q96* probably null Het
Cd101 C T 3: 101,008,199 S684N probably benign Het
Cdh16 T G 8: 104,618,533 I375L probably benign Het
Chchd6 A G 6: 89,574,454 V75A probably benign Het
Coro2a A T 4: 46,551,374 N110K probably damaging Het
Cyp2c69 A G 19: 39,881,499 V93A probably benign Het
Egln3 C T 12: 54,180,641 A235T probably benign Het
Fryl T C 5: 73,054,781 T2335A probably damaging Het
Fzd3 T C 14: 65,235,803 D172G probably benign Het
Galnt2 T A 8: 124,340,822 W447R probably damaging Het
Iqce A G 5: 140,675,235 L450P probably benign Het
Ly9 T C 1: 171,594,085 T533A possibly damaging Het
Map3k19 A C 1: 127,824,232 F257V probably benign Het
Mroh7 GTT GTTT 4: 106,680,713 probably null Het
Olfr202 A T 16: 59,283,951 V182E probably benign Het
Pcdhb11 A T 18: 37,422,144 I176F probably benign Het
Pkd1 A G 17: 24,569,413 D715G probably damaging Het
Plxnd1 A C 6: 115,969,929 L828R possibly damaging Het
Pramef20 C T 4: 144,373,173 V341I probably benign Het
Psmd2 T A 16: 20,662,636 S814T probably benign Het
Pusl1 A G 4: 155,891,116 S87P probably benign Het
Rgs3 T A 4: 62,602,943 D34E probably benign Het
Rhof A G 5: 123,131,936 F53L probably damaging Het
Sik3 C A 9: 46,212,553 P1217T probably benign Het
Skiv2l G A 17: 34,845,190 R507* probably null Het
Slc14a2 A G 18: 78,192,174 Y263H probably damaging Het
Slc26a4 C T 12: 31,526,600 probably null Het
Smyd3 T G 1: 179,395,830 H178P probably benign Het
Thada T C 17: 84,454,414 probably null Het
Top1mt A C 15: 75,669,488 probably null Het
Trim17 A T 11: 58,971,025 probably null Het
Ttn A T 2: 76,940,051 F2599I possibly damaging Het
Tuba3a A T 6: 125,281,645 D127E probably benign Het
Ucp1 A G 8: 83,291,477 T68A probably benign Het
Vmn2r69 A G 7: 85,411,143 V411A probably benign Het
Vmn2r74 A T 7: 85,957,550 V196E probably damaging Het
Wdr59 T C 8: 111,501,052 Y131C probably damaging Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zbtb21 G T 16: 97,951,082 S667Y probably damaging Het
Other mutations in Pigp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02100:Pigp APN 16 94364767 nonsense probably null
IGL02728:Pigp APN 16 94367607 missense probably damaging 1.00
schweinchen UTSW 16 94365441 missense probably damaging 1.00
R0092:Pigp UTSW 16 94365462 missense probably damaging 0.96
R3614:Pigp UTSW 16 94364724 missense possibly damaging 0.91
R4872:Pigp UTSW 16 94365450 missense probably benign 0.18
R4959:Pigp UTSW 16 94359147 missense probably benign 0.00
R4973:Pigp UTSW 16 94359147 missense probably benign 0.00
R5970:Pigp UTSW 16 94370194 critical splice acceptor site probably null
R6135:Pigp UTSW 16 94370206 missense probably benign 0.20
R6179:Pigp UTSW 16 94370367 missense probably null 0.99
R7576:Pigp UTSW 16 94370405 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- GAATGTATCAGATGACTTTCTCCCAAC -3'
(R):5'- TCTGCAGCTGTTCATTGGCC -3'

Sequencing Primer
(F):5'- AACGTGTTTCTTAGGCCTATTTCTG -3'
(R):5'- AGCTGTTCATTGGCCCCTTATAG -3'
Posted On2018-08-01