Incidental Mutation 'R6732:Cyp2c69'
ID530131
Institutional Source Beutler Lab
Gene Symbol Cyp2c69
Ensembl Gene ENSMUSG00000092008
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 69
SynonymsAI098658
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R6732 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location39842660-39886769 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39881499 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 93 (V93A)
Ref Sequence ENSEMBL: ENSMUSP00000132832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168838]
Predicted Effect probably benign
Transcript: ENSMUST00000168838
AA Change: V93A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132832
Gene: ENSMUSG00000092008
AA Change: V93A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 487 7e-152 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,810,820 probably null Het
Abcb11 A G 2: 69,286,846 I486T probably damaging Het
Abcc5 T C 16: 20,404,684 N158S probably benign Het
AI182371 G T 2: 35,084,705 probably benign Het
Ap1ar G A 3: 127,815,685 Q96* probably null Het
Cd101 C T 3: 101,008,199 S684N probably benign Het
Cdh16 T G 8: 104,618,533 I375L probably benign Het
Chchd6 A G 6: 89,574,454 V75A probably benign Het
Coro2a A T 4: 46,551,374 N110K probably damaging Het
Egln3 C T 12: 54,180,641 A235T probably benign Het
Fryl T C 5: 73,054,781 T2335A probably damaging Het
Fzd3 T C 14: 65,235,803 D172G probably benign Het
Galnt2 T A 8: 124,340,822 W447R probably damaging Het
Iqce A G 5: 140,675,235 L450P probably benign Het
Ly9 T C 1: 171,594,085 T533A possibly damaging Het
Map3k19 A C 1: 127,824,232 F257V probably benign Het
Mroh7 GTT GTTT 4: 106,680,713 probably null Het
Olfr202 A T 16: 59,283,951 V182E probably benign Het
Pcdhb11 A T 18: 37,422,144 I176F probably benign Het
Pigp A C 16: 94,365,441 L96R probably damaging Het
Pkd1 A G 17: 24,569,413 D715G probably damaging Het
Plxnd1 A C 6: 115,969,929 L828R possibly damaging Het
Pramef20 C T 4: 144,373,173 V341I probably benign Het
Psmd2 T A 16: 20,662,636 S814T probably benign Het
Pusl1 A G 4: 155,891,116 S87P probably benign Het
Rgs3 T A 4: 62,602,943 D34E probably benign Het
Rhof A G 5: 123,131,936 F53L probably damaging Het
Sik3 C A 9: 46,212,553 P1217T probably benign Het
Skiv2l G A 17: 34,845,190 R507* probably null Het
Slc14a2 A G 18: 78,192,174 Y263H probably damaging Het
Slc26a4 C T 12: 31,526,600 probably null Het
Smyd3 T G 1: 179,395,830 H178P probably benign Het
Thada T C 17: 84,454,414 probably null Het
Top1mt A C 15: 75,669,488 probably null Het
Trim17 A T 11: 58,971,025 probably null Het
Ttn A T 2: 76,940,051 F2599I possibly damaging Het
Tuba3a A T 6: 125,281,645 D127E probably benign Het
Ucp1 A G 8: 83,291,477 T68A probably benign Het
Vmn2r69 A G 7: 85,411,143 V411A probably benign Het
Vmn2r74 A T 7: 85,957,550 V196E probably damaging Het
Wdr59 T C 8: 111,501,052 Y131C probably damaging Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zbtb21 G T 16: 97,951,082 S667Y probably damaging Het
Other mutations in Cyp2c69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01873:Cyp2c69 APN 19 39881249 splice site probably benign
IGL02127:Cyp2c69 APN 19 39851057 missense probably damaging 0.99
IGL02945:Cyp2c69 APN 19 39886647 missense possibly damaging 0.81
IGL03067:Cyp2c69 APN 19 39881093 missense probably benign 0.29
IGL03069:Cyp2c69 APN 19 39881093 missense probably benign 0.29
R0545:Cyp2c69 UTSW 19 39886661 missense probably damaging 1.00
R1276:Cyp2c69 UTSW 19 39876224 missense possibly damaging 0.47
R1468:Cyp2c69 UTSW 19 39849395 missense probably damaging 1.00
R1468:Cyp2c69 UTSW 19 39849395 missense probably damaging 1.00
R1534:Cyp2c69 UTSW 19 39851149 missense probably benign
R1549:Cyp2c69 UTSW 19 39842986 missense probably benign 0.11
R1703:Cyp2c69 UTSW 19 39876366 missense probably benign 0.10
R1752:Cyp2c69 UTSW 19 39881153 missense probably damaging 1.00
R1769:Cyp2c69 UTSW 19 39876371 missense probably benign 0.00
R1843:Cyp2c69 UTSW 19 39877528 missense probably benign 0.27
R1938:Cyp2c69 UTSW 19 39849366 missense probably damaging 0.97
R2100:Cyp2c69 UTSW 19 39886686 missense probably benign 0.11
R2366:Cyp2c69 UTSW 19 39877594 missense probably benign 0.12
R2367:Cyp2c69 UTSW 19 39877594 missense probably benign 0.12
R2440:Cyp2c69 UTSW 19 39876294 missense probably benign 0.17
R2931:Cyp2c69 UTSW 19 39849483 missense probably damaging 1.00
R3709:Cyp2c69 UTSW 19 39851223 splice site probably benign
R3793:Cyp2c69 UTSW 19 39881156 missense probably benign 0.44
R3898:Cyp2c69 UTSW 19 39876390 missense probably benign 0.00
R4579:Cyp2c69 UTSW 19 39881186 missense possibly damaging 0.89
R4707:Cyp2c69 UTSW 19 39849408 missense probably benign 0.39
R4778:Cyp2c69 UTSW 19 39877594 missense probably benign 0.12
R4779:Cyp2c69 UTSW 19 39877594 missense probably benign 0.12
R4780:Cyp2c69 UTSW 19 39877594 missense probably benign 0.12
R4838:Cyp2c69 UTSW 19 39877594 missense probably benign 0.12
R4877:Cyp2c69 UTSW 19 39877612 missense probably damaging 1.00
R5488:Cyp2c69 UTSW 19 39851159 missense probably null 0.94
R5489:Cyp2c69 UTSW 19 39851159 missense probably null 0.94
R6083:Cyp2c69 UTSW 19 39849456 missense probably damaging 1.00
R6278:Cyp2c69 UTSW 19 39843063 nonsense probably null
R6415:Cyp2c69 UTSW 19 39842921 missense probably benign 0.44
R6858:Cyp2c69 UTSW 19 39877565 missense probably benign 0.19
R7023:Cyp2c69 UTSW 19 39877542 missense probably benign 0.43
R7227:Cyp2c69 UTSW 19 39881166 missense possibly damaging 0.77
R7228:Cyp2c69 UTSW 19 39881166 missense possibly damaging 0.77
R7260:Cyp2c69 UTSW 19 39842900 missense probably benign 0.00
R7262:Cyp2c69 UTSW 19 39886732 start gained probably benign
R7479:Cyp2c69 UTSW 19 39881557 missense probably benign 0.00
R7570:Cyp2c69 UTSW 19 39859898 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACAAGCAAGCATGACCTC -3'
(R):5'- CAGACTTTAAACTGGGGTTTTCTG -3'

Sequencing Primer
(F):5'- GCAAGCATGACCTCTACTCTC -3'
(R):5'- ACTGGGGTTTTCTGACTAAAAATATC -3'
Posted On2018-08-01