Incidental Mutation 'R6733:Fer1l5'
ID530132
Institutional Source Beutler Lab
Gene Symbol Fer1l5
Ensembl Gene ENSMUSG00000037432
Gene Namefer-1-like 5 (C. elegans)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R6733 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location36372291-36422110 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 36408672 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179162] [ENSMUST00000179162]
Predicted Effect probably null
Transcript: ENSMUST00000179162
SMART Domains Protein: ENSMUSP00000142130
Gene: ENSMUSG00000037432

DomainStartEndE-ValueType
C2 1 98 2.74e-4 SMART
C2 168 264 4.29e-6 SMART
FerI 250 323 1.59e-19 SMART
C2 325 422 1.06e-5 SMART
FerA 602 669 6.26e-18 SMART
FerB 691 764 1.38e-37 SMART
internal_repeat_1 781 836 1.77e-5 PROSPERO
internal_repeat_1 852 904 1.77e-5 PROSPERO
DysFC 913 951 1.61e-3 SMART
DysFC 981 1013 4.81e-2 SMART
C2 1078 1222 1.56e0 SMART
Pfam:C2 1248 1329 1e-1 PFAM
low complexity region 1376 1387 N/A INTRINSIC
low complexity region 1459 1470 N/A INTRINSIC
C2 1487 1586 2.21e-8 SMART
C2 1659 1851 5.32e-2 SMART
transmembrane domain 1964 1986 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000179162
SMART Domains Protein: ENSMUSP00000142130
Gene: ENSMUSG00000037432

DomainStartEndE-ValueType
C2 1 98 2.74e-4 SMART
C2 168 264 4.29e-6 SMART
FerI 250 323 1.59e-19 SMART
C2 325 422 1.06e-5 SMART
FerA 602 669 6.26e-18 SMART
FerB 691 764 1.38e-37 SMART
internal_repeat_1 781 836 1.77e-5 PROSPERO
internal_repeat_1 852 904 1.77e-5 PROSPERO
DysFC 913 951 1.61e-3 SMART
DysFC 981 1013 4.81e-2 SMART
C2 1078 1222 1.56e0 SMART
Pfam:C2 1248 1329 1e-1 PFAM
low complexity region 1376 1387 N/A INTRINSIC
low complexity region 1459 1470 N/A INTRINSIC
C2 1487 1586 2.21e-8 SMART
C2 1659 1851 5.32e-2 SMART
transmembrane domain 1964 1986 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202030
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,930,530 S155P probably damaging Het
Afdn C T 17: 13,823,353 H358Y probably benign Het
Ccdc125 T A 13: 100,694,487 M394K probably benign Het
Cfd C A 10: 79,891,802 H103Q probably damaging Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Dedd2 T C 7: 25,203,907 E209G probably benign Het
Dnah3 A G 7: 119,922,974 S3999P probably benign Het
H6pd A T 4: 149,985,121 probably null Het
Il25 T C 14: 54,933,033 I21T probably benign Het
Kmt2c C T 5: 25,409,293 S143N probably damaging Het
Marveld3 T C 8: 109,962,049 D20G possibly damaging Het
Msl1 A G 11: 98,800,056 E122G probably damaging Het
Obscn A T 11: 59,028,595 V6861E probably damaging Het
Olfr1447 A T 19: 12,901,241 C180S probably damaging Het
Phc1 A T 6: 122,336,886 M29K possibly damaging Het
Pkd1l3 T A 8: 109,648,494 probably null Het
Prl5a1 G T 13: 28,149,936 V141F possibly damaging Het
Psg20 A T 7: 18,674,622 V391D probably damaging Het
Ptprh T C 7: 4,603,044 probably null Het
Rasa3 T C 8: 13,580,037 E580G possibly damaging Het
Ror1 T C 4: 100,426,055 V439A probably benign Het
Rsl1 A G 13: 67,177,142 T81A probably benign Het
Sgpp1 G C 12: 75,735,469 P32R probably benign Het
Slc22a8 T C 19: 8,609,292 L389P probably benign Het
Slc6a11 A G 6: 114,134,898 Y142C probably damaging Het
Syt9 C T 7: 107,425,296 T132I probably damaging Het
Thop1 T A 10: 81,081,412 I583N probably damaging Het
Tom1l1 A G 11: 90,685,060 probably null Het
Unk A G 11: 116,050,755 D276G probably damaging Het
Zfp942 C A 17: 21,928,752 E299* probably null Het
Zkscan6 A G 11: 65,828,635 T494A probably damaging Het
Zscan25 T A 5: 145,290,913 probably null Het
Other mutations in Fer1l5
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4151001:Fer1l5 UTSW 1 36411647 missense probably benign 0.27
R5580:Fer1l5 UTSW 1 36385458 nonsense probably null
R5848:Fer1l5 UTSW 1 36388935 missense probably benign 0.39
R5930:Fer1l5 UTSW 1 36385173 nonsense probably null
R6193:Fer1l5 UTSW 1 36409436 missense probably benign 0.20
R6195:Fer1l5 UTSW 1 36375286 splice site probably null
R6207:Fer1l5 UTSW 1 36385160 missense probably damaging 1.00
R6233:Fer1l5 UTSW 1 36375286 splice site probably null
R6349:Fer1l5 UTSW 1 36411274 missense probably damaging 0.96
R6478:Fer1l5 UTSW 1 36402531 missense probably damaging 1.00
R6514:Fer1l5 UTSW 1 36403616 missense probably benign 0.01
R6611:Fer1l5 UTSW 1 36406654 missense probably benign 0.01
R6634:Fer1l5 UTSW 1 36411385 missense probably damaging 0.99
R6816:Fer1l5 UTSW 1 36406510 missense possibly damaging 0.60
R7225:Fer1l5 UTSW 1 36420952 missense possibly damaging 0.90
R7316:Fer1l5 UTSW 1 36418116 missense probably benign 0.41
R7455:Fer1l5 UTSW 1 36388983 missense probably benign 0.00
R7473:Fer1l5 UTSW 1 36421608 missense possibly damaging 0.53
R7702:Fer1l5 UTSW 1 36420694 nonsense probably null
R7714:Fer1l5 UTSW 1 36401477 missense probably damaging 1.00
R7872:Fer1l5 UTSW 1 36421886 missense probably benign 0.00
R7881:Fer1l5 UTSW 1 36407036 missense not run
R7984:Fer1l5 UTSW 1 36408621 missense possibly damaging 0.68
R8326:Fer1l5 UTSW 1 36376760 missense probably benign 0.04
Z1176:Fer1l5 UTSW 1 36390563 nonsense probably null
Z1177:Fer1l5 UTSW 1 36409194 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AAGTCACGATGCTGCTCCTG -3'
(R):5'- ATATGGAAGCTACACCCCTGTC -3'

Sequencing Primer
(F):5'- CTCCTGCAGGCTGGGAGTATG -3'
(R):5'- TCCTTGTTGGGCGCCAG -3'
Posted On2018-08-01