Mutagenetix > Incidental Mutations

Incidental Mutation 'R6733:H6pd'

530134

Institutional Source

Beutler Lab

Gene Symbol

H6pd

Ensembl Gene

ENSMUSG00000028980

Gene Name

hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)

Synonyms

Gpd-1, Gpd1, G6pd1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.102) question?

Stock #

R6733 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

149979475-150009023 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 149985121 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000081134 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030830] [ENSMUST00000084117]

Predicted Effect

probably null
Transcript: ENSMUST00000030830

SMART Domains

Protein: ENSMUSP00000030830
Gene: ENSMUSG00000028980

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:G6PD_N	34	218	1.6e-41	PFAM
Pfam:G6PD_C	220	523	3.2e-58	PFAM
Pfam:Glucosamine_iso	564	788	8.2e-66	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000084117

SMART Domains

Protein: ENSMUSP00000081134
Gene: ENSMUSG00000028980

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Pfam:G6PD_N	26	210	8.6e-39	PFAM
Pfam:G6PD_C	212	387	3.6e-42	PFAM
Pfam:Glucosamine_iso	561	758	9.9e-62	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] There are 2 forms of glucose-6-phosphate dehydrogenase. G form is X-linked and H form, encoded by this gene, is autosomally linked. This H form shows activity with other hexose-6-phosphates, especially galactose-6-phosphate, whereas the G form is specific for glucose-6-phosphate. Both forms are present in most tissues, but H form is not found in red cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show enlarged adrenal glands, reduced plasma corticosterone levels and altered 11 beta-hydroxysteroid dehydrogenase type 1 enzyme activity. Treatment with 11-dehydrocorticosterone fails to inhibit glucose-stimulatedinsulin secretion in pancreatic islets. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	T	C	6: 48,930,530	S155P	probably damaging	Het
Afdn	C	T	17: 13,823,353	H358Y	probably benign	Het
Ccdc125	T	A	13: 100,694,487	M394K	probably benign	Het
Cfd	C	A	10: 79,891,802	H103Q	probably damaging	Het
Cnot2	G	A	10: 116,498,153	P371S	possibly damaging	Het
Dedd2	T	C	7: 25,203,907	E209G	probably benign	Het
Dnah3	A	G	7: 119,922,974	S3999P	probably benign	Het
Fer1l5	T	C	1: 36,408,672		probably null	Het
Il25	T	C	14: 54,933,033	I21T	probably benign	Het
Kmt2c	C	T	5: 25,409,293	S143N	probably damaging	Het
Marveld3	T	C	8: 109,962,049	D20G	possibly damaging	Het
Msl1	A	G	11: 98,800,056	E122G	probably damaging	Het
Obscn	A	T	11: 59,028,595	V6861E	probably damaging	Het
Olfr1447	A	T	19: 12,901,241	C180S	probably damaging	Het
Phc1	A	T	6: 122,336,886	M29K	possibly damaging	Het
Pkd1l3	T	A	8: 109,648,494		probably null	Het
Prl5a1	G	T	13: 28,149,936	V141F	possibly damaging	Het
Psg20	A	T	7: 18,674,622	V391D	probably damaging	Het
Ptprh	T	C	7: 4,603,044		probably null	Het
Rasa3	T	C	8: 13,580,037	E580G	possibly damaging	Het
Ror1	T	C	4: 100,426,055	V439A	probably benign	Het
Rsl1	A	G	13: 67,177,142	T81A	probably benign	Het
Sgpp1	G	C	12: 75,735,469	P32R	probably benign	Het
Slc22a8	T	C	19: 8,609,292	L389P	probably benign	Het
Slc6a11	A	G	6: 114,134,898	Y142C	probably damaging	Het
Syt9	C	T	7: 107,425,296	T132I	probably damaging	Het
Thop1	T	A	10: 81,081,412	I583N	probably damaging	Het
Tom1l1	A	G	11: 90,685,060		probably null	Het
Unk	A	G	11: 116,050,755	D276G	probably damaging	Het
Zfp942	C	A	17: 21,928,752	E299*	probably null	Het
Zkscan6	A	G	11: 65,828,635	T494A	probably damaging	Het
Zscan25	T	A	5: 145,290,913		probably null	Het

Other mutations in H6pd

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00916:H6pd	APN	4	149994468	critical splice donor site	probably null
IGL01450:H6pd	APN	4	149984118	missense	probably damaging	1.00
IGL01913:H6pd	APN	4	149994463	unclassified	probably benign
IGL01914:H6pd	APN	4	149994463	unclassified	probably benign
dryer	UTSW	4	149982865	missense	probably damaging	1.00
herr	UTSW	4	149983902	critical splice donor site	probably null
G1patch:H6pd	UTSW	4	149996358	missense	probably damaging	1.00
R0402:H6pd	UTSW	4	149996316	missense	probably damaging	1.00
R0486:H6pd	UTSW	4	149982936	splice site	probably benign
R0548:H6pd	UTSW	4	149981616	missense	probably damaging	1.00
R0690:H6pd	UTSW	4	149982573	missense	possibly damaging	0.93
R1165:H6pd	UTSW	4	149995956	missense	possibly damaging	0.95
R1298:H6pd	UTSW	4	149982514	missense	probably benign	0.01
R1331:H6pd	UTSW	4	149982415	missense	probably benign	0.28
R1581:H6pd	UTSW	4	149982514	missense	possibly damaging	0.94
R1781:H6pd	UTSW	4	149995931	missense	probably damaging	1.00
R1791:H6pd	UTSW	4	149981673	missense	probably damaging	0.97
R1840:H6pd	UTSW	4	149982050	missense	possibly damaging	0.55
R2290:H6pd	UTSW	4	149981881	missense	probably damaging	1.00
R3889:H6pd	UTSW	4	149995773	missense	possibly damaging	0.67
R4432:H6pd	UTSW	4	149995758	missense	probably damaging	1.00
R4576:H6pd	UTSW	4	149994476	missense	probably damaging	0.99
R4629:H6pd	UTSW	4	149996346	missense	probably benign	0.10
R4856:H6pd	UTSW	4	149982778	missense	possibly damaging	0.47
R4886:H6pd	UTSW	4	149982778	missense	possibly damaging	0.47
R4951:H6pd	UTSW	4	149981587	missense	probably damaging	1.00
R5124:H6pd	UTSW	4	149982055	missense	possibly damaging	0.57
R5337:H6pd	UTSW	4	149981784	missense	probably benign	0.02
R5408:H6pd	UTSW	4	149982865	missense	probably damaging	1.00
R5474:H6pd	UTSW	4	149996089	missense	probably damaging	1.00
R6266:H6pd	UTSW	4	149995957	missense	probably benign	0.32
R6476:H6pd	UTSW	4	149982727	missense	probably damaging	0.99
R6725:H6pd	UTSW	4	149996358	missense	probably damaging	1.00
R6785:H6pd	UTSW	4	149982790	missense	possibly damaging	0.50
R6853:H6pd	UTSW	4	149982462	missense	probably benign	0.00
R6921:H6pd	UTSW	4	149982051	missense	probably damaging	0.99
R7258:H6pd	UTSW	4	149996362	missense	probably benign	0.09
R7269:H6pd	UTSW	4	149982912	missense	probably benign	0.00
R7326:H6pd	UTSW	4	149996350	missense	probably benign	0.00
R7348:H6pd	UTSW	4	149983902	critical splice donor site	probably null
R7488:H6pd	UTSW	4	149982636	missense	probably benign
R7512:H6pd	UTSW	4	149995948	missense	probably benign	0.00
R7684:H6pd	UTSW	4	149996062	missense	probably benign
R7704:H6pd	UTSW	4	149982903	missense	probably benign	0.45
R7954:H6pd	UTSW	4	149982826	missense	probably benign
R8226:H6pd	UTSW	4	149995989	missense	probably benign	0.02
R8420:H6pd	UTSW	4	149981676	missense	probably benign	0.01
X0020:H6pd	UTSW	4	149982798	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTAAGGTACAGTGCCAGGGC -3'
(R):5'- CCTTCATGGTTCGAGAGTGAC -3'

Sequencing Primer
(F):5'- TACAGTGCCAGGGCTCCAAG -3'
(R):5'- CCTTCATGGTTCGAGAGTGACATATG -3'

Posted On

2018-08-01