Incidental Mutation 'R6733:H6pd'
ID530134
Institutional Source Beutler Lab
Gene Symbol H6pd
Ensembl Gene ENSMUSG00000028980
Gene Namehexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)
SynonymsGpd-1, Gpd1, G6pd1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R6733 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location149979475-150009023 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 149985121 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000081134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030830] [ENSMUST00000084117]
Predicted Effect probably null
Transcript: ENSMUST00000030830
SMART Domains Protein: ENSMUSP00000030830
Gene: ENSMUSG00000028980

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:G6PD_N 34 218 1.6e-41 PFAM
Pfam:G6PD_C 220 523 3.2e-58 PFAM
Pfam:Glucosamine_iso 564 788 8.2e-66 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000084117
SMART Domains Protein: ENSMUSP00000081134
Gene: ENSMUSG00000028980

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:G6PD_N 26 210 8.6e-39 PFAM
Pfam:G6PD_C 212 387 3.6e-42 PFAM
Pfam:Glucosamine_iso 561 758 9.9e-62 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] There are 2 forms of glucose-6-phosphate dehydrogenase. G form is X-linked and H form, encoded by this gene, is autosomally linked. This H form shows activity with other hexose-6-phosphates, especially galactose-6-phosphate, whereas the G form is specific for glucose-6-phosphate. Both forms are present in most tissues, but H form is not found in red cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show enlarged adrenal glands, reduced plasma corticosterone levels and altered 11 beta-hydroxysteroid dehydrogenase type 1 enzyme activity. Treatment with 11-dehydrocorticosterone fails to inhibit glucose-stimulatedinsulin secretion in pancreatic islets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,930,530 S155P probably damaging Het
Afdn C T 17: 13,823,353 H358Y probably benign Het
Ccdc125 T A 13: 100,694,487 M394K probably benign Het
Cfd C A 10: 79,891,802 H103Q probably damaging Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Dedd2 T C 7: 25,203,907 E209G probably benign Het
Dnah3 A G 7: 119,922,974 S3999P probably benign Het
Fer1l5 T C 1: 36,408,672 probably null Het
Il25 T C 14: 54,933,033 I21T probably benign Het
Kmt2c C T 5: 25,409,293 S143N probably damaging Het
Marveld3 T C 8: 109,962,049 D20G possibly damaging Het
Msl1 A G 11: 98,800,056 E122G probably damaging Het
Obscn A T 11: 59,028,595 V6861E probably damaging Het
Olfr1447 A T 19: 12,901,241 C180S probably damaging Het
Phc1 A T 6: 122,336,886 M29K possibly damaging Het
Pkd1l3 T A 8: 109,648,494 probably null Het
Prl5a1 G T 13: 28,149,936 V141F possibly damaging Het
Psg20 A T 7: 18,674,622 V391D probably damaging Het
Ptprh T C 7: 4,603,044 probably null Het
Rasa3 T C 8: 13,580,037 E580G possibly damaging Het
Ror1 T C 4: 100,426,055 V439A probably benign Het
Rsl1 A G 13: 67,177,142 T81A probably benign Het
Sgpp1 G C 12: 75,735,469 P32R probably benign Het
Slc22a8 T C 19: 8,609,292 L389P probably benign Het
Slc6a11 A G 6: 114,134,898 Y142C probably damaging Het
Syt9 C T 7: 107,425,296 T132I probably damaging Het
Thop1 T A 10: 81,081,412 I583N probably damaging Het
Tom1l1 A G 11: 90,685,060 probably null Het
Unk A G 11: 116,050,755 D276G probably damaging Het
Zfp942 C A 17: 21,928,752 E299* probably null Het
Zkscan6 A G 11: 65,828,635 T494A probably damaging Het
Zscan25 T A 5: 145,290,913 probably null Het
Other mutations in H6pd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:H6pd APN 4 149994468 critical splice donor site probably null
IGL01450:H6pd APN 4 149984118 missense probably damaging 1.00
IGL01913:H6pd APN 4 149994463 unclassified probably benign
IGL01914:H6pd APN 4 149994463 unclassified probably benign
dryer UTSW 4 149982865 missense probably damaging 1.00
herr UTSW 4 149983902 critical splice donor site probably null
R0402:H6pd UTSW 4 149996316 missense probably damaging 1.00
R0486:H6pd UTSW 4 149982936 splice site probably benign
R0548:H6pd UTSW 4 149981616 missense probably damaging 1.00
R0690:H6pd UTSW 4 149982573 missense possibly damaging 0.93
R1165:H6pd UTSW 4 149995956 missense possibly damaging 0.95
R1298:H6pd UTSW 4 149982514 missense probably benign 0.01
R1331:H6pd UTSW 4 149982415 missense probably benign 0.28
R1581:H6pd UTSW 4 149982514 missense possibly damaging 0.94
R1781:H6pd UTSW 4 149995931 missense probably damaging 1.00
R1791:H6pd UTSW 4 149981673 missense probably damaging 0.97
R1840:H6pd UTSW 4 149982050 missense possibly damaging 0.55
R2290:H6pd UTSW 4 149981881 missense probably damaging 1.00
R3889:H6pd UTSW 4 149995773 missense possibly damaging 0.67
R4432:H6pd UTSW 4 149995758 missense probably damaging 1.00
R4576:H6pd UTSW 4 149994476 missense probably damaging 0.99
R4629:H6pd UTSW 4 149996346 missense probably benign 0.10
R4856:H6pd UTSW 4 149982778 missense possibly damaging 0.47
R4886:H6pd UTSW 4 149982778 missense possibly damaging 0.47
R4951:H6pd UTSW 4 149981587 missense probably damaging 1.00
R5124:H6pd UTSW 4 149982055 missense possibly damaging 0.57
R5337:H6pd UTSW 4 149981784 missense probably benign 0.02
R5408:H6pd UTSW 4 149982865 missense probably damaging 1.00
R5474:H6pd UTSW 4 149996089 missense probably damaging 1.00
R6266:H6pd UTSW 4 149995957 missense probably benign 0.32
R6476:H6pd UTSW 4 149982727 missense probably damaging 0.99
R6725:H6pd UTSW 4 149996358 missense probably damaging 1.00
R6785:H6pd UTSW 4 149982790 missense possibly damaging 0.50
R6853:H6pd UTSW 4 149982462 missense probably benign 0.00
R6921:H6pd UTSW 4 149982051 missense probably damaging 0.99
R7258:H6pd UTSW 4 149996362 missense probably benign 0.09
R7269:H6pd UTSW 4 149982912 missense probably benign 0.00
R7326:H6pd UTSW 4 149996350 missense probably benign 0.00
R7348:H6pd UTSW 4 149983902 critical splice donor site probably null
R7488:H6pd UTSW 4 149982636 missense probably benign
R7512:H6pd UTSW 4 149995948 missense probably benign 0.00
R7684:H6pd UTSW 4 149996062 missense probably benign
R7704:H6pd UTSW 4 149982903 missense probably benign 0.45
X0020:H6pd UTSW 4 149982798 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTAAGGTACAGTGCCAGGGC -3'
(R):5'- CCTTCATGGTTCGAGAGTGAC -3'

Sequencing Primer
(F):5'- TACAGTGCCAGGGCTCCAAG -3'
(R):5'- CCTTCATGGTTCGAGAGTGACATATG -3'
Posted On2018-08-01