Incidental Mutation 'R6733:Zscan25'
ID530136
Institutional Source Beutler Lab
Gene Symbol Zscan25
Ensembl Gene ENSMUSG00000070420
Gene Namezinc finger and SCAN domain containing 25
SynonymsZfp498, EG666311
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R6733 (G1)
Quality Score189.009
Status Not validated
Chromosome5
Chromosomal Location145280500-145291278 bp(+) (GRCm38)
Type of Mutationsplice site (4451 bp from exon)
DNA Base Change (assembly) T to A at 145290913 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094116] [ENSMUST00000199563] [ENSMUST00000200246]
Predicted Effect probably null
Transcript: ENSMUST00000094116
AA Change: C462*
SMART Domains Protein: ENSMUSP00000091664
Gene: ENSMUSG00000070420
AA Change: C462*

DomainStartEndE-ValueType
SCAN 38 150 5.94e-53 SMART
Blast:KRAB 231 288 4e-31 BLAST
ZnF_C2H2 346 368 2.15e-5 SMART
ZnF_C2H2 374 396 5.06e-2 SMART
ZnF_C2H2 402 424 8.34e-3 SMART
ZnF_C2H2 430 452 3.39e-3 SMART
ZnF_C2H2 458 479 1.08e1 SMART
ZnF_C2H2 485 507 4.47e-3 SMART
ZnF_C2H2 513 536 5.59e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197174
Predicted Effect probably benign
Transcript: ENSMUST00000199563
SMART Domains Protein: ENSMUSP00000143449
Gene: ENSMUSG00000070420

DomainStartEndE-ValueType
SCAN 38 150 2.1e-54 SMART
Predicted Effect probably null
Transcript: ENSMUST00000200246
SMART Domains Protein: ENSMUSP00000142367
Gene: ENSMUSG00000070420

DomainStartEndE-ValueType
SCAN 38 150 1.9e-55 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that bears some similarity to zinc finger proteins, which are involved in DNA binding and protein-protein interactions. Multiple alternatively spliced transcript variants have been identified, but the full-length nature for most of them has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,930,530 S155P probably damaging Het
Afdn C T 17: 13,823,353 H358Y probably benign Het
Ccdc125 T A 13: 100,694,487 M394K probably benign Het
Cfd C A 10: 79,891,802 H103Q probably damaging Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Dedd2 T C 7: 25,203,907 E209G probably benign Het
Dnah3 A G 7: 119,922,974 S3999P probably benign Het
Fer1l5 T C 1: 36,408,672 probably null Het
H6pd A T 4: 149,985,121 probably null Het
Il25 T C 14: 54,933,033 I21T probably benign Het
Kmt2c C T 5: 25,409,293 S143N probably damaging Het
Marveld3 T C 8: 109,962,049 D20G possibly damaging Het
Msl1 A G 11: 98,800,056 E122G probably damaging Het
Obscn A T 11: 59,028,595 V6861E probably damaging Het
Olfr1447 A T 19: 12,901,241 C180S probably damaging Het
Phc1 A T 6: 122,336,886 M29K possibly damaging Het
Pkd1l3 T A 8: 109,648,494 probably null Het
Prl5a1 G T 13: 28,149,936 V141F possibly damaging Het
Psg20 A T 7: 18,674,622 V391D probably damaging Het
Ptprh T C 7: 4,603,044 probably null Het
Rasa3 T C 8: 13,580,037 E580G possibly damaging Het
Ror1 T C 4: 100,426,055 V439A probably benign Het
Rsl1 A G 13: 67,177,142 T81A probably benign Het
Sgpp1 G C 12: 75,735,469 P32R probably benign Het
Slc22a8 T C 19: 8,609,292 L389P probably benign Het
Slc6a11 A G 6: 114,134,898 Y142C probably damaging Het
Syt9 C T 7: 107,425,296 T132I probably damaging Het
Thop1 T A 10: 81,081,412 I583N probably damaging Het
Tom1l1 A G 11: 90,685,060 probably null Het
Unk A G 11: 116,050,755 D276G probably damaging Het
Zfp942 C A 17: 21,928,752 E299* probably null Het
Zkscan6 A G 11: 65,828,635 T494A probably damaging Het
Other mutations in Zscan25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Zscan25 APN 5 145283749 missense probably damaging 1.00
IGL02622:Zscan25 APN 5 145290702 missense probably damaging 1.00
IGL02881:Zscan25 APN 5 145290486 missense probably benign 0.25
PIT4445001:Zscan25 UTSW 5 145290612 missense probably damaging 1.00
R1713:Zscan25 UTSW 5 145283691 missense probably damaging 0.99
R1828:Zscan25 UTSW 5 145291048 missense possibly damaging 0.95
R2233:Zscan25 UTSW 5 145283692 missense probably damaging 1.00
R3882:Zscan25 UTSW 5 145291052 missense probably damaging 1.00
R4330:Zscan25 UTSW 5 145290551 missense probably damaging 0.99
R4527:Zscan25 UTSW 5 145283458 missense probably damaging 1.00
R4539:Zscan25 UTSW 5 145288391 missense probably benign 0.01
R4598:Zscan25 UTSW 5 145291005 missense probably benign 0.30
R4611:Zscan25 UTSW 5 145291116 missense probably damaging 1.00
R4662:Zscan25 UTSW 5 145286310 missense unknown
R6751:Zscan25 UTSW 5 145290563 missense probably damaging 1.00
R7161:Zscan25 UTSW 5 145286441 missense probably benign 0.00
R7912:Zscan25 UTSW 5 145290511 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTGCTGGAAGACCTTCAGC -3'
(R):5'- TTAGTAGGCTCACTGCACCG -3'

Sequencing Primer
(F):5'- CTGGAAGACCTTCAGCCAGAG -3'
(R):5'- ACCTCTGGTTGAAGCTGC -3'
Posted On2018-08-01