Incidental Mutation 'R6733:1600015I10Rik'
ID 530137
Institutional Source Beutler Lab
Gene Symbol 1600015I10Rik
Ensembl Gene ENSMUSG00000029813
Gene Name RIKEN cDNA 1600015I10 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock # R6733 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 48929895-48933687 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 48930530 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 155 (S155P)
Ref Sequence ENSEMBL: ENSMUSP00000031837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031837]
AlphaFold E9Q745
Predicted Effect probably damaging
Transcript: ENSMUST00000031837
AA Change: S155P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031837
Gene: ENSMUSG00000029813
AA Change: S155P

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 50 136 1.7e-25 PFAM
Pfam:Cu_amine_oxidN3 152 252 3.5e-16 PFAM
Pfam:Cu_amine_oxid 306 708 7.1e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158710
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn C T 17: 13,823,353 H358Y probably benign Het
Ccdc125 T A 13: 100,694,487 M394K probably benign Het
Cfd C A 10: 79,891,802 H103Q probably damaging Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Dedd2 T C 7: 25,203,907 E209G probably benign Het
Dnah3 A G 7: 119,922,974 S3999P probably benign Het
Fer1l5 T C 1: 36,408,672 probably null Het
H6pd A T 4: 149,985,121 probably null Het
Il25 T C 14: 54,933,033 I21T probably benign Het
Kmt2c C T 5: 25,409,293 S143N probably damaging Het
Marveld3 T C 8: 109,962,049 D20G possibly damaging Het
Msl1 A G 11: 98,800,056 E122G probably damaging Het
Obscn A T 11: 59,028,595 V6861E probably damaging Het
Olfr1447 A T 19: 12,901,241 C180S probably damaging Het
Phc1 A T 6: 122,336,886 M29K possibly damaging Het
Pkd1l3 T A 8: 109,648,494 probably null Het
Prl5a1 G T 13: 28,149,936 V141F possibly damaging Het
Psg20 A T 7: 18,674,622 V391D probably damaging Het
Ptprh T C 7: 4,603,044 probably null Het
Rasa3 T C 8: 13,580,037 E580G possibly damaging Het
Ror1 T C 4: 100,426,055 V439A probably benign Het
Rsl1 A G 13: 67,177,142 T81A probably benign Het
Sgpp1 G C 12: 75,735,469 P32R probably benign Het
Slc22a8 T C 19: 8,609,292 L389P probably benign Het
Slc6a11 A G 6: 114,134,898 Y142C probably damaging Het
Syt9 C T 7: 107,425,296 T132I probably damaging Het
Thop1 T A 10: 81,081,412 I583N probably damaging Het
Tom1l1 A G 11: 90,685,060 probably null Het
Unk A G 11: 116,050,755 D276G probably damaging Het
Zfp942 C A 17: 21,928,752 E299* probably null Het
Zkscan6 A G 11: 65,828,635 T494A probably damaging Het
Zscan25 T A 5: 145,290,913 probably null Het
Other mutations in 1600015I10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:1600015I10Rik APN 6 48931040 missense probably damaging 1.00
IGL01347:1600015I10Rik APN 6 48932543 missense probably benign 0.02
IGL01751:1600015I10Rik APN 6 48930588 missense possibly damaging 0.79
IGL01915:1600015I10Rik APN 6 48931648 missense probably damaging 1.00
IGL02669:1600015I10Rik APN 6 48931473 missense probably damaging 1.00
IGL03033:1600015I10Rik APN 6 48932518 missense probably benign 0.00
IGL03242:1600015I10Rik APN 6 48932545 missense possibly damaging 0.68
R0096:1600015I10Rik UTSW 6 48931188 missense probably damaging 1.00
R0096:1600015I10Rik UTSW 6 48931188 missense probably damaging 1.00
R0448:1600015I10Rik UTSW 6 48933057 missense probably damaging 1.00
R1488:1600015I10Rik UTSW 6 48933447 missense possibly damaging 0.91
R1498:1600015I10Rik UTSW 6 48931371 missense probably benign 0.00
R1520:1600015I10Rik UTSW 6 48931297 nonsense probably null
R1922:1600015I10Rik UTSW 6 48931286 missense probably benign 0.00
R1992:1600015I10Rik UTSW 6 48930769 missense probably damaging 1.00
R1997:1600015I10Rik UTSW 6 48932429 missense probably damaging 0.98
R2021:1600015I10Rik UTSW 6 48931451 missense probably damaging 1.00
R3771:1600015I10Rik UTSW 6 48931196 missense probably damaging 1.00
R4208:1600015I10Rik UTSW 6 48931647 missense probably damaging 1.00
R4790:1600015I10Rik UTSW 6 48930552 missense probably damaging 0.99
R5114:1600015I10Rik UTSW 6 48931358 missense probably benign 0.02
R5610:1600015I10Rik UTSW 6 48931019 missense probably benign 0.00
R5823:1600015I10Rik UTSW 6 48930552 missense probably damaging 0.99
R5847:1600015I10Rik UTSW 6 48933478 missense probably damaging 1.00
R6233:1600015I10Rik UTSW 6 48930965 missense probably benign
R6357:1600015I10Rik UTSW 6 48930974 missense probably benign 0.00
R6694:1600015I10Rik UTSW 6 48930546 missense probably benign 0.21
R6894:1600015I10Rik UTSW 6 48930662 missense probably damaging 1.00
R6898:1600015I10Rik UTSW 6 48931041 missense probably damaging 0.97
R6916:1600015I10Rik UTSW 6 48931053 missense probably benign 0.01
R7242:1600015I10Rik UTSW 6 48931128 missense probably damaging 1.00
R7762:1600015I10Rik UTSW 6 48932686 missense probably benign 0.07
R8257:1600015I10Rik UTSW 6 48932497 missense probably benign 0.04
R8391:1600015I10Rik UTSW 6 48932668 missense probably damaging 0.96
R8839:1600015I10Rik UTSW 6 48931040 missense probably damaging 1.00
R8863:1600015I10Rik UTSW 6 48930108 missense probably benign 0.00
R9266:1600015I10Rik UTSW 6 48930237 missense probably benign 0.00
R9274:1600015I10Rik UTSW 6 48930407 missense possibly damaging 0.94
R9380:1600015I10Rik UTSW 6 48933130 missense probably damaging 1.00
R9382:1600015I10Rik UTSW 6 48930364 missense probably benign 0.08
R9562:1600015I10Rik UTSW 6 48930975 missense probably benign 0.01
R9565:1600015I10Rik UTSW 6 48930975 missense probably benign 0.01
X0062:1600015I10Rik UTSW 6 48933132 missense possibly damaging 0.55
Z1176:1600015I10Rik UTSW 6 48932468 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- CATAGAAATGCTGCTGCCCG -3'
(R):5'- GTTGCAACATGAACCAGCTAC -3'

Sequencing Primer
(F):5'- AATGCTGCTGCCCGATAAG -3'
(R):5'- CTACAGCGCTGGTCAGATTTTG -3'
Posted On 2018-08-01