Incidental Mutation 'R6733:Slc6a11'
ID530138
Institutional Source Beutler Lab
Gene Symbol Slc6a11
Ensembl Gene ENSMUSG00000030307
Gene Namesolute carrier family 6 (neurotransmitter transporter, GABA), member 11
SynonymsGabt4, E130202I16Rik, Gat3, D930045G19Rik, GAT4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6733 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location114131241-114249952 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 114134898 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 142 (Y142C)
Ref Sequence ENSEMBL: ENSMUSP00000032451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032451]
Predicted Effect probably damaging
Transcript: ENSMUST00000032451
AA Change: Y142C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032451
Gene: ENSMUSG00000030307
AA Change: Y142C

DomainStartEndE-ValueType
low complexity region 25 33 N/A INTRINSIC
Pfam:SNF 45 571 4.1e-250 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203105
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a sodium-dependent transporter that uptakes gamma-aminobutyric acid (GABA), an inhibitory neurotransmitter, which ends the GABA neurotransmission. Defects in this gene may result in epilepsy, behavioral problems, or intellectual problems. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a targeted mutation display postnatal lethality. Mice heterozygous for a targeted mutation display resistance to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,930,530 S155P probably damaging Het
Afdn C T 17: 13,823,353 H358Y probably benign Het
Ccdc125 T A 13: 100,694,487 M394K probably benign Het
Cfd C A 10: 79,891,802 H103Q probably damaging Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Dedd2 T C 7: 25,203,907 E209G probably benign Het
Dnah3 A G 7: 119,922,974 S3999P probably benign Het
Fer1l5 T C 1: 36,408,672 probably null Het
H6pd A T 4: 149,985,121 probably null Het
Il25 T C 14: 54,933,033 I21T probably benign Het
Kmt2c C T 5: 25,409,293 S143N probably damaging Het
Marveld3 T C 8: 109,962,049 D20G possibly damaging Het
Msl1 A G 11: 98,800,056 E122G probably damaging Het
Obscn A T 11: 59,028,595 V6861E probably damaging Het
Olfr1447 A T 19: 12,901,241 C180S probably damaging Het
Phc1 A T 6: 122,336,886 M29K possibly damaging Het
Pkd1l3 T A 8: 109,648,494 probably null Het
Prl5a1 G T 13: 28,149,936 V141F possibly damaging Het
Psg20 A T 7: 18,674,622 V391D probably damaging Het
Ptprh T C 7: 4,603,044 probably null Het
Rasa3 T C 8: 13,580,037 E580G possibly damaging Het
Ror1 T C 4: 100,426,055 V439A probably benign Het
Rsl1 A G 13: 67,177,142 T81A probably benign Het
Sgpp1 G C 12: 75,735,469 P32R probably benign Het
Slc22a8 T C 19: 8,609,292 L389P probably benign Het
Syt9 C T 7: 107,425,296 T132I probably damaging Het
Thop1 T A 10: 81,081,412 I583N probably damaging Het
Tom1l1 A G 11: 90,685,060 probably null Het
Unk A G 11: 116,050,755 D276G probably damaging Het
Zfp942 C A 17: 21,928,752 E299* probably null Het
Zkscan6 A G 11: 65,828,635 T494A probably damaging Het
Zscan25 T A 5: 145,290,913 probably null Het
Other mutations in Slc6a11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Slc6a11 APN 6 114134665 missense probably damaging 1.00
IGL01306:Slc6a11 APN 6 114134665 missense probably damaging 1.00
IGL01308:Slc6a11 APN 6 114134665 missense probably damaging 1.00
IGL01616:Slc6a11 APN 6 114134868 missense possibly damaging 0.93
IGL01985:Slc6a11 APN 6 114134892 missense probably benign 0.43
IGL02270:Slc6a11 APN 6 114238396 missense probably damaging 1.00
IGL02692:Slc6a11 APN 6 114162139 missense probably damaging 1.00
IGL02828:Slc6a11 APN 6 114134987 missense possibly damaging 0.53
IGL03135:Slc6a11 APN 6 114194609 critical splice acceptor site probably null
ANU23:Slc6a11 UTSW 6 114134665 missense probably damaging 1.00
R0603:Slc6a11 UTSW 6 114244890 missense probably benign 0.03
R1147:Slc6a11 UTSW 6 114244870 missense possibly damaging 0.90
R1147:Slc6a11 UTSW 6 114244870 missense possibly damaging 0.90
R1219:Slc6a11 UTSW 6 114225811 splice site probably benign
R1226:Slc6a11 UTSW 6 114194663 missense possibly damaging 0.93
R1676:Slc6a11 UTSW 6 114247666 missense probably benign
R2231:Slc6a11 UTSW 6 114194629 missense probably damaging 1.00
R2297:Slc6a11 UTSW 6 114131425 missense probably benign 0.37
R4384:Slc6a11 UTSW 6 114247727 missense possibly damaging 0.47
R4556:Slc6a11 UTSW 6 114244812 missense probably benign 0.00
R4564:Slc6a11 UTSW 6 114131362 missense probably benign 0.00
R5488:Slc6a11 UTSW 6 114243894 missense probably damaging 1.00
R5736:Slc6a11 UTSW 6 114162162 missense probably damaging 1.00
R6021:Slc6a11 UTSW 6 114230051 missense probably damaging 1.00
R6150:Slc6a11 UTSW 6 114245618 missense probably benign 0.08
R7391:Slc6a11 UTSW 6 114238461 missense probably benign
R7451:Slc6a11 UTSW 6 114245683 nonsense probably null
R7750:Slc6a11 UTSW 6 114230137 missense possibly damaging 0.82
R8115:Slc6a11 UTSW 6 114131481 missense probably damaging 1.00
R8179:Slc6a11 UTSW 6 114245606 missense probably benign 0.01
R8411:Slc6a11 UTSW 6 114131437 missense probably benign 0.18
R8512:Slc6a11 UTSW 6 114238441 missense probably damaging 1.00
Z1177:Slc6a11 UTSW 6 114247642 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTCTTCCTGGAAACGGCTCTG -3'
(R):5'- TTGTTCCAGAAGCCACACC -3'

Sequencing Primer
(F):5'- CTGCCCTTTATTTGAAGGTAAGC -3'
(R):5'- GAAGCCACACCCTGGAAACTG -3'
Posted On2018-08-01