Mutagenetix > Incidental Mutations

Incidental Mutation 'R6733:Dedd2'

530142

Institutional Source

Beutler Lab

Gene Symbol

Dedd2

Ensembl Gene

ENSMUSG00000054499

Gene Name

death effector domain-containing DNA binding protein 2

Synonyms

FLAME-3, 2410050E11Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.124) question?

Stock #

R6733 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

25199915-25220615 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 25203907 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 209 (E209G)

Ref Sequence

ENSEMBL: ENSMUSP00000146052 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058702] [ENSMUST00000205271]

Predicted Effect

probably benign
Transcript: ENSMUST00000058702
AA Change: E209G

PolyPhen 2 Score 0.303 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000049763
Gene: ENSMUSG00000054499
AA Change: E209G

Domain	Start	End	E-Value	Type
DED	24	104	6.34e-13	SMART
low complexity region	130	147	N/A	INTRINSIC
low complexity region	157	182	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000205271
AA Change: E209G

PolyPhen 2 Score 0.303 (Sensitivity: 0.90; Specificity: 0.89)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206750

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear-localized protein containing a death effector domain (DED). The encoded protein may regulate the trafficking of caspases and other proteins into the nucleus during death receptor-induced apoptosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	T	C	6: 48,930,530	S155P	probably damaging	Het
Afdn	C	T	17: 13,823,353	H358Y	probably benign	Het
Ccdc125	T	A	13: 100,694,487	M394K	probably benign	Het
Cfd	C	A	10: 79,891,802	H103Q	probably damaging	Het
Cnot2	G	A	10: 116,498,153	P371S	possibly damaging	Het
Dnah3	A	G	7: 119,922,974	S3999P	probably benign	Het
Fer1l5	T	C	1: 36,408,672		probably null	Het
H6pd	A	T	4: 149,985,121		probably null	Het
Il25	T	C	14: 54,933,033	I21T	probably benign	Het
Kmt2c	C	T	5: 25,409,293	S143N	probably damaging	Het
Marveld3	T	C	8: 109,962,049	D20G	possibly damaging	Het
Msl1	A	G	11: 98,800,056	E122G	probably damaging	Het
Obscn	A	T	11: 59,028,595	V6861E	probably damaging	Het
Olfr1447	A	T	19: 12,901,241	C180S	probably damaging	Het
Phc1	A	T	6: 122,336,886	M29K	possibly damaging	Het
Pkd1l3	T	A	8: 109,648,494		probably null	Het
Prl5a1	G	T	13: 28,149,936	V141F	possibly damaging	Het
Psg20	A	T	7: 18,674,622	V391D	probably damaging	Het
Ptprh	T	C	7: 4,603,044		probably null	Het
Rasa3	T	C	8: 13,580,037	E580G	possibly damaging	Het
Ror1	T	C	4: 100,426,055	V439A	probably benign	Het
Rsl1	A	G	13: 67,177,142	T81A	probably benign	Het
Sgpp1	G	C	12: 75,735,469	P32R	probably benign	Het
Slc22a8	T	C	19: 8,609,292	L389P	probably benign	Het
Slc6a11	A	G	6: 114,134,898	Y142C	probably damaging	Het
Syt9	C	T	7: 107,425,296	T132I	probably damaging	Het
Thop1	T	A	10: 81,081,412	I583N	probably damaging	Het
Tom1l1	A	G	11: 90,685,060		probably null	Het
Unk	A	G	11: 116,050,755	D276G	probably damaging	Het
Zfp942	C	A	17: 21,928,752	E299*	probably null	Het
Zkscan6	A	G	11: 65,828,635	T494A	probably damaging	Het
Zscan25	T	A	5: 145,290,913		probably null	Het

Other mutations in Dedd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0346:Dedd2	UTSW	7	25211269	missense	possibly damaging	0.46
R0480:Dedd2	UTSW	7	25203625	missense	probably damaging	1.00
R0838:Dedd2	UTSW	7	25211187	missense	probably benign	0.10
R5000:Dedd2	UTSW	7	25203643	missense	possibly damaging	0.91
R5085:Dedd2	UTSW	7	25218986	missense	probably damaging	1.00
R6082:Dedd2	UTSW	7	25211290	missense	probably benign	0.02
R6083:Dedd2	UTSW	7	25211290	missense	probably benign	0.02
R6084:Dedd2	UTSW	7	25211290	missense	probably benign	0.02
R6264:Dedd2	UTSW	7	25203790	missense	possibly damaging	0.84
R6646:Dedd2	UTSW	7	25203613	missense	probably damaging	1.00
R7267:Dedd2	UTSW	7	25218966	missense	probably damaging	0.99
R8465:Dedd2	UTSW	7	25218906	missense	probably damaging	0.99
Z1176:Dedd2	UTSW	7	25203598	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCCGTAAAGCCTCAGTCAG -3'
(R):5'- AGGCTGCCTTGTGATTCAGG -3'

Sequencing Primer
(F):5'- TCAGGTAGTCGCCCCAGAAG -3'
(R):5'- CCTTGTGATTCAGGGAGTTGAG -3'

Posted On

2018-08-01