Incidental Mutation 'R6733:Dedd2'
ID530142
Institutional Source Beutler Lab
Gene Symbol Dedd2
Ensembl Gene ENSMUSG00000054499
Gene Namedeath effector domain-containing DNA binding protein 2
SynonymsFLAME-3, 2410050E11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R6733 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location25199915-25220615 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25203907 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 209 (E209G)
Ref Sequence ENSEMBL: ENSMUSP00000146052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058702] [ENSMUST00000205271]
Predicted Effect probably benign
Transcript: ENSMUST00000058702
AA Change: E209G

PolyPhen 2 Score 0.303 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000049763
Gene: ENSMUSG00000054499
AA Change: E209G

DomainStartEndE-ValueType
DED 24 104 6.34e-13 SMART
low complexity region 130 147 N/A INTRINSIC
low complexity region 157 182 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205271
AA Change: E209G

PolyPhen 2 Score 0.303 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206750
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear-localized protein containing a death effector domain (DED). The encoded protein may regulate the trafficking of caspases and other proteins into the nucleus during death receptor-induced apoptosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,930,530 S155P probably damaging Het
Afdn C T 17: 13,823,353 H358Y probably benign Het
Ccdc125 T A 13: 100,694,487 M394K probably benign Het
Cfd C A 10: 79,891,802 H103Q probably damaging Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Dnah3 A G 7: 119,922,974 S3999P probably benign Het
Fer1l5 T C 1: 36,408,672 probably null Het
H6pd A T 4: 149,985,121 probably null Het
Il25 T C 14: 54,933,033 I21T probably benign Het
Kmt2c C T 5: 25,409,293 S143N probably damaging Het
Marveld3 T C 8: 109,962,049 D20G possibly damaging Het
Msl1 A G 11: 98,800,056 E122G probably damaging Het
Obscn A T 11: 59,028,595 V6861E probably damaging Het
Olfr1447 A T 19: 12,901,241 C180S probably damaging Het
Phc1 A T 6: 122,336,886 M29K possibly damaging Het
Pkd1l3 T A 8: 109,648,494 probably null Het
Prl5a1 G T 13: 28,149,936 V141F possibly damaging Het
Psg20 A T 7: 18,674,622 V391D probably damaging Het
Ptprh T C 7: 4,603,044 probably null Het
Rasa3 T C 8: 13,580,037 E580G possibly damaging Het
Ror1 T C 4: 100,426,055 V439A probably benign Het
Rsl1 A G 13: 67,177,142 T81A probably benign Het
Sgpp1 G C 12: 75,735,469 P32R probably benign Het
Slc22a8 T C 19: 8,609,292 L389P probably benign Het
Slc6a11 A G 6: 114,134,898 Y142C probably damaging Het
Syt9 C T 7: 107,425,296 T132I probably damaging Het
Thop1 T A 10: 81,081,412 I583N probably damaging Het
Tom1l1 A G 11: 90,685,060 probably null Het
Unk A G 11: 116,050,755 D276G probably damaging Het
Zfp942 C A 17: 21,928,752 E299* probably null Het
Zkscan6 A G 11: 65,828,635 T494A probably damaging Het
Zscan25 T A 5: 145,290,913 probably null Het
Other mutations in Dedd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0346:Dedd2 UTSW 7 25211269 missense possibly damaging 0.46
R0480:Dedd2 UTSW 7 25203625 missense probably damaging 1.00
R0838:Dedd2 UTSW 7 25211187 missense probably benign 0.10
R5000:Dedd2 UTSW 7 25203643 missense possibly damaging 0.91
R5085:Dedd2 UTSW 7 25218986 missense probably damaging 1.00
R6082:Dedd2 UTSW 7 25211290 missense probably benign 0.02
R6083:Dedd2 UTSW 7 25211290 missense probably benign 0.02
R6084:Dedd2 UTSW 7 25211290 missense probably benign 0.02
R6264:Dedd2 UTSW 7 25203790 missense possibly damaging 0.84
R6646:Dedd2 UTSW 7 25203613 missense probably damaging 1.00
R7267:Dedd2 UTSW 7 25218966 missense probably damaging 0.99
Z1176:Dedd2 UTSW 7 25203598 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCGTAAAGCCTCAGTCAG -3'
(R):5'- AGGCTGCCTTGTGATTCAGG -3'

Sequencing Primer
(F):5'- TCAGGTAGTCGCCCCAGAAG -3'
(R):5'- CCTTGTGATTCAGGGAGTTGAG -3'
Posted On2018-08-01