Mutagenetix > Incidental Mutation

Incidental Mutation 'R6733:Syt9'

530143

Institutional Source

Beutler Lab

Gene Symbol

Syt9

Ensembl Gene

ENSMUSG00000062542

Gene Name

synaptotagmin IX

Synonyms

Sytv

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6733 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

107370728-107548656 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 107425296 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 132 (T132I)

Ref Sequence

ENSEMBL: ENSMUSP00000122049 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073459] [ENSMUST00000130414] [ENSMUST00000137663]

AlphaFold

Q9R0N9

Predicted Effect

probably damaging
Transcript: ENSMUST00000073459
AA Change: T132I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000073164
Gene: ENSMUSG00000062542
AA Change: T132I

Domain	Start	End	E-Value	Type
low complexity region	37	49	N/A	INTRINSIC
Blast:C2	53	166	7e-54	BLAST
C2	236	339	1.8e-26	SMART
C2	368	482	1.6e-25	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000130414
AA Change: T132I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000122049
Gene: ENSMUSG00000062542
AA Change: T132I

Domain	Start	End	E-Value	Type
low complexity region	37	49	N/A	INTRINSIC
Blast:C2	53	166	3e-57	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000137663

SMART Domains

Protein: ENSMUSP00000117969
Gene: ENSMUSG00000062542

Domain	Start	End	E-Value	Type
low complexity region	37	48	N/A	INTRINSIC

Meta Mutation Damage Score

0.1223

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.5%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit 50% embryonic lethality while cre-mediated removal of a conditional allele impairs inhibitions of postsynaptic currents. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	T	C	6: 48,930,530	S155P	probably damaging	Het
Afdn	C	T	17: 13,823,353	H358Y	probably benign	Het
Ccdc125	T	A	13: 100,694,487	M394K	probably benign	Het
Cfd	C	A	10: 79,891,802	H103Q	probably damaging	Het
Cnot2	G	A	10: 116,498,153	P371S	possibly damaging	Het
Dedd2	T	C	7: 25,203,907	E209G	probably benign	Het
Dnah3	A	G	7: 119,922,974	S3999P	probably benign	Het
Fer1l5	T	C	1: 36,408,672		probably null	Het
H6pd	A	T	4: 149,985,121		probably null	Het
Il25	T	C	14: 54,933,033	I21T	probably benign	Het
Kmt2c	C	T	5: 25,409,293	S143N	probably damaging	Het
Marveld3	T	C	8: 109,962,049	D20G	possibly damaging	Het
Msl1	A	G	11: 98,800,056	E122G	probably damaging	Het
Obscn	A	T	11: 59,028,595	V6861E	probably damaging	Het
Olfr1447	A	T	19: 12,901,241	C180S	probably damaging	Het
Phc1	A	T	6: 122,336,886	M29K	possibly damaging	Het
Pkd1l3	T	A	8: 109,648,494		probably null	Het
Prl5a1	G	T	13: 28,149,936	V141F	possibly damaging	Het
Psg20	A	T	7: 18,674,622	V391D	probably damaging	Het
Ptprh	T	C	7: 4,603,044		probably null	Het
Rasa3	T	C	8: 13,580,037	E580G	possibly damaging	Het
Ror1	T	C	4: 100,426,055	V439A	probably benign	Het
Rsl1	A	G	13: 67,177,142	T81A	probably benign	Het
Sgpp1	G	C	12: 75,735,469	P32R	probably benign	Het
Slc22a8	T	C	19: 8,609,292	L389P	probably benign	Het
Slc6a11	A	G	6: 114,134,898	Y142C	probably damaging	Het
Thop1	T	A	10: 81,081,412	I583N	probably damaging	Het
Tom1l1	A	G	11: 90,685,060		probably null	Het
Unk	A	G	11: 116,050,755	D276G	probably damaging	Het
Zfp942	C	A	17: 21,928,752	E299*	probably null	Het
Zkscan6	A	G	11: 65,828,635	T494A	probably damaging	Het
Zscan25	T	A	5: 145,290,913		probably null	Het

Other mutations in Syt9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00508:Syt9	APN	7	107425367	nonsense	probably null
IGL00541:Syt9	APN	7	107502180	missense	probably null	1.00
IGL01161:Syt9	APN	7	107425149	missense	probably damaging	0.97
IGL01705:Syt9	APN	7	107436352	missense	probably damaging	0.96
IGL02567:Syt9	APN	7	107436661	missense	probably damaging	1.00
IGL03268:Syt9	APN	7	107436405	missense	probably benign	0.01
R0684:Syt9	UTSW	7	107425136	missense	probably damaging	1.00
R0743:Syt9	UTSW	7	107436561	missense	probably damaging	0.97
R0835:Syt9	UTSW	7	107506530	missense	probably benign	0.30
R0884:Syt9	UTSW	7	107436561	missense	probably damaging	0.97
R1114:Syt9	UTSW	7	107425355	missense	possibly damaging	0.93
R1502:Syt9	UTSW	7	107436487	missense	probably damaging	1.00
R1885:Syt9	UTSW	7	107436529	missense	probably damaging	1.00
R1962:Syt9	UTSW	7	107425107	missense	probably damaging	1.00
R2368:Syt9	UTSW	7	107436699	missense	probably damaging	1.00
R2421:Syt9	UTSW	7	107436781	missense	probably benign	0.39
R4134:Syt9	UTSW	7	107436423	missense	probably benign	0.22
R4477:Syt9	UTSW	7	107425221	missense	probably damaging	1.00
R4602:Syt9	UTSW	7	107436387	nonsense	probably null
R4685:Syt9	UTSW	7	107436471	missense	possibly damaging	0.89
R4977:Syt9	UTSW	7	107504272	missense	probably damaging	1.00
R5141:Syt9	UTSW	7	107504219	missense	probably damaging	1.00
R5421:Syt9	UTSW	7	107425356	missense	probably benign	0.00
R5440:Syt9	UTSW	7	107502123	missense	possibly damaging	0.46
R5633:Syt9	UTSW	7	107425296	missense	probably damaging	1.00
R5978:Syt9	UTSW	7	107436413	missense	probably benign	0.02
R6260:Syt9	UTSW	7	107436510	missense	possibly damaging	0.93
R6889:Syt9	UTSW	7	107425286	missense	probably damaging	0.99
R7572:Syt9	UTSW	7	107436577	missense	probably damaging	1.00
R8080:Syt9	UTSW	7	107436790	missense	probably benign
X0018:Syt9	UTSW	7	107506574	missense	probably benign	0.20

Predicted Primers

PCR Primer
(F):5'- AAACTGTGCTGGGTTCCGTG -3'
(R):5'- TAGGTCCACAGAGTTTCCCC -3'

Sequencing Primer
(F):5'- CTGGGTTCCGTGGCGAGAG -3'
(R):5'- GGCATCTAGATTCTCAGCTAGTCAG -3'

Posted On

2018-08-01