Incidental Mutation 'R6733:Cfd'
ID530148
Institutional Source Beutler Lab
Gene Symbol Cfd
Ensembl Gene ENSMUSG00000061780
Gene Namecomplement factor D (adipsin)
Synonymsfactor D, D component (adipsin) of complement, Adn, DF
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R6733 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location79890853-79892655 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 79891802 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 103 (H103Q)
Ref Sequence ENSEMBL: ENSMUSP00000151894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046091] [ENSMUST00000061653] [ENSMUST00000105378] [ENSMUST00000165684] [ENSMUST00000217837]
Predicted Effect probably benign
Transcript: ENSMUST00000046091
SMART Domains Protein: ENSMUSP00000038925
Gene: ENSMUSG00000020125

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Tryp_SPc 28 242 3.74e-74 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000061653
AA Change: H104Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056836
Gene: ENSMUSG00000061780
AA Change: H104Q

DomainStartEndE-ValueType
Tryp_SPc 25 249 8.25e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105378
SMART Domains Protein: ENSMUSP00000101017
Gene: ENSMUSG00000013833

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
WD40 94 133 1.05e-7 SMART
Blast:WD40 143 169 4e-8 BLAST
low complexity region 206 217 N/A INTRINSIC
WD40 226 267 1.53e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165684
SMART Domains Protein: ENSMUSP00000129375
Gene: ENSMUSG00000013833

DomainStartEndE-ValueType
low complexity region 13 25 N/A INTRINSIC
WD40 95 134 1.05e-7 SMART
Blast:WD40 144 170 4e-8 BLAST
low complexity region 207 218 N/A INTRINSIC
WD40 227 268 1.53e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000217837
AA Change: H103Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218521
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a serine protease that plays an important role in the alternative pathway of complement activation for pathogen recognition and elimination. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional enzyme that in turn cleaves factor B in the complement pathway. This gene is expressed in adipocytes and the mature enzyme is secreted into the bloodstream. Mice lacking the encoded product cannot initiate alternative pathway of complement activation. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele show impaired complement activation by alternative pathway activators, and increased susceptibility to pneumococcal infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,930,530 S155P probably damaging Het
Afdn C T 17: 13,823,353 H358Y probably benign Het
Ccdc125 T A 13: 100,694,487 M394K probably benign Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Dedd2 T C 7: 25,203,907 E209G probably benign Het
Dnah3 A G 7: 119,922,974 S3999P probably benign Het
Fer1l5 T C 1: 36,408,672 probably null Het
H6pd A T 4: 149,985,121 probably null Het
Il25 T C 14: 54,933,033 I21T probably benign Het
Kmt2c C T 5: 25,409,293 S143N probably damaging Het
Marveld3 T C 8: 109,962,049 D20G possibly damaging Het
Msl1 A G 11: 98,800,056 E122G probably damaging Het
Obscn A T 11: 59,028,595 V6861E probably damaging Het
Olfr1447 A T 19: 12,901,241 C180S probably damaging Het
Phc1 A T 6: 122,336,886 M29K possibly damaging Het
Pkd1l3 T A 8: 109,648,494 probably null Het
Prl5a1 G T 13: 28,149,936 V141F possibly damaging Het
Psg20 A T 7: 18,674,622 V391D probably damaging Het
Ptprh T C 7: 4,603,044 probably null Het
Rasa3 T C 8: 13,580,037 E580G possibly damaging Het
Ror1 T C 4: 100,426,055 V439A probably benign Het
Rsl1 A G 13: 67,177,142 T81A probably benign Het
Sgpp1 G C 12: 75,735,469 P32R probably benign Het
Slc22a8 T C 19: 8,609,292 L389P probably benign Het
Slc6a11 A G 6: 114,134,898 Y142C probably damaging Het
Syt9 C T 7: 107,425,296 T132I probably damaging Het
Thop1 T A 10: 81,081,412 I583N probably damaging Het
Tom1l1 A G 11: 90,685,060 probably null Het
Unk A G 11: 116,050,755 D276G probably damaging Het
Zfp942 C A 17: 21,928,752 E299* probably null Het
Zkscan6 A G 11: 65,828,635 T494A probably damaging Het
Zscan25 T A 5: 145,290,913 probably null Het
Other mutations in Cfd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02049:Cfd APN 10 79890942 missense probably benign
R0325:Cfd UTSW 10 79891758 nonsense probably null
R1376:Cfd UTSW 10 79892152 missense possibly damaging 0.89
R1376:Cfd UTSW 10 79892152 missense possibly damaging 0.89
R1708:Cfd UTSW 10 79891607 missense probably benign 0.00
R2221:Cfd UTSW 10 79892205 splice site probably null
R2223:Cfd UTSW 10 79892205 splice site probably null
R4823:Cfd UTSW 10 79890948 missense probably benign
R5388:Cfd UTSW 10 79892125 missense probably damaging 1.00
R6687:Cfd UTSW 10 79891719 missense probably damaging 0.99
R7085:Cfd UTSW 10 79892492 missense probably damaging 1.00
R7123:Cfd UTSW 10 79892497 missense probably damaging 1.00
R7451:Cfd UTSW 10 79891528 missense probably damaging 1.00
R7669:Cfd UTSW 10 79891613 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTACATGGCTTCCGTGCAAG -3'
(R):5'- ATGTCTGAGTAGGGGCAGAGTC -3'

Sequencing Primer
(F):5'- ATGGCTTCCGTGCAAGTGAAC -3'
(R):5'- TCAAGAAAAGAGATCTGAAGCTGG -3'
Posted On2018-08-01