Incidental Mutation 'R6733:Cnot2'
ID530150
Institutional Source Beutler Lab
Gene Symbol Cnot2
Ensembl Gene ENSMUSG00000020166
Gene NameCCR4-NOT transcription complex, subunit 2
Synonyms2810470K03Rik, 2600016M12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.869) question?
Stock #R6733 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location116485161-116581511 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 116498153 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 371 (P371S)
Ref Sequence ENSEMBL: ENSMUSP00000132152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105265] [ENSMUST00000105267] [ENSMUST00000164088] [ENSMUST00000167706] [ENSMUST00000168036] [ENSMUST00000169576] [ENSMUST00000169921]
Predicted Effect probably benign
Transcript: ENSMUST00000105265
AA Change: P286S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000100900
Gene: ENSMUSG00000020166
AA Change: P286S

DomainStartEndE-ValueType
low complexity region 68 87 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
Pfam:NOT2_3_5 310 437 1e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105267
AA Change: P371S

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000100902
Gene: ENSMUSG00000020166
AA Change: P371S

DomainStartEndE-ValueType
low complexity region 153 172 N/A INTRINSIC
low complexity region 298 312 N/A INTRINSIC
Pfam:NOT2_3_5 396 521 8.8e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000164088
AA Change: P330S

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127830
Gene: ENSMUSG00000020166
AA Change: P330S

DomainStartEndE-ValueType
low complexity region 112 131 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
Pfam:NOT2_3_5 354 481 2.6e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164383
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166166
Predicted Effect possibly damaging
Transcript: ENSMUST00000167706
AA Change: P321S

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000128837
Gene: ENSMUSG00000020166
AA Change: P321S

DomainStartEndE-ValueType
low complexity region 153 172 N/A INTRINSIC
low complexity region 248 262 N/A INTRINSIC
Pfam:NOT2_3_5 345 472 2.5e-37 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000168036
AA Change: P330S

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132315
Gene: ENSMUSG00000020166
AA Change: P330S

DomainStartEndE-ValueType
low complexity region 112 131 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
Pfam:NOT2_3_5 354 481 2.6e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169576
Predicted Effect possibly damaging
Transcript: ENSMUST00000169921
AA Change: P371S

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132152
Gene: ENSMUSG00000020166
AA Change: P371S

DomainStartEndE-ValueType
low complexity region 153 172 N/A INTRINSIC
low complexity region 298 312 N/A INTRINSIC
Pfam:NOT2_3_5 395 522 1.2e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169937
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219544
Meta Mutation Damage Score 0.1595 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the multi-component CCR4-NOT complex. The CCR4-NOT complex regulates mRNA synthesis and degradation and is also thought to be involved in mRNA splicing, transport and localization. The encoded protein interacts with histone deacetylases and functions as a repressor of polymerase II transcription. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,930,530 S155P probably damaging Het
Afdn C T 17: 13,823,353 H358Y probably benign Het
Ccdc125 T A 13: 100,694,487 M394K probably benign Het
Cfd C A 10: 79,891,802 H103Q probably damaging Het
Dedd2 T C 7: 25,203,907 E209G probably benign Het
Dnah3 A G 7: 119,922,974 S3999P probably benign Het
Fer1l5 T C 1: 36,408,672 probably null Het
H6pd A T 4: 149,985,121 probably null Het
Il25 T C 14: 54,933,033 I21T probably benign Het
Kmt2c C T 5: 25,409,293 S143N probably damaging Het
Marveld3 T C 8: 109,962,049 D20G possibly damaging Het
Msl1 A G 11: 98,800,056 E122G probably damaging Het
Obscn A T 11: 59,028,595 V6861E probably damaging Het
Olfr1447 A T 19: 12,901,241 C180S probably damaging Het
Phc1 A T 6: 122,336,886 M29K possibly damaging Het
Pkd1l3 T A 8: 109,648,494 probably null Het
Prl5a1 G T 13: 28,149,936 V141F possibly damaging Het
Psg20 A T 7: 18,674,622 V391D probably damaging Het
Ptprh T C 7: 4,603,044 probably null Het
Rasa3 T C 8: 13,580,037 E580G possibly damaging Het
Ror1 T C 4: 100,426,055 V439A probably benign Het
Rsl1 A G 13: 67,177,142 T81A probably benign Het
Sgpp1 G C 12: 75,735,469 P32R probably benign Het
Slc22a8 T C 19: 8,609,292 L389P probably benign Het
Slc6a11 A G 6: 114,134,898 Y142C probably damaging Het
Syt9 C T 7: 107,425,296 T132I probably damaging Het
Thop1 T A 10: 81,081,412 I583N probably damaging Het
Tom1l1 A G 11: 90,685,060 probably null Het
Unk A G 11: 116,050,755 D276G probably damaging Het
Zfp942 C A 17: 21,928,752 E299* probably null Het
Zkscan6 A G 11: 65,828,635 T494A probably damaging Het
Zscan25 T A 5: 145,290,913 probably null Het
Other mutations in Cnot2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Cnot2 APN 10 116507071 missense probably benign 0.02
IGL02433:Cnot2 APN 10 116492336 missense possibly damaging 0.82
IGL03066:Cnot2 APN 10 116499357 missense probably benign 0.15
IGL03383:Cnot2 APN 10 116494817 splice site probably benign
R0145:Cnot2 UTSW 10 116517368 missense possibly damaging 0.90
R0497:Cnot2 UTSW 10 116498355 missense probably damaging 1.00
R0615:Cnot2 UTSW 10 116498236 missense possibly damaging 0.89
R1935:Cnot2 UTSW 10 116498415 missense possibly damaging 0.62
R1985:Cnot2 UTSW 10 116527876 missense probably damaging 0.99
R2148:Cnot2 UTSW 10 116506280 missense probably benign 0.01
R4063:Cnot2 UTSW 10 116537396 missense possibly damaging 0.46
R4179:Cnot2 UTSW 10 116498143 missense possibly damaging 0.81
R4196:Cnot2 UTSW 10 116501304 missense possibly damaging 0.62
R4523:Cnot2 UTSW 10 116581474 unclassified probably benign
R4572:Cnot2 UTSW 10 116494846 missense probably benign 0.37
R4610:Cnot2 UTSW 10 116499418 missense probably damaging 1.00
R5219:Cnot2 UTSW 10 116506310 splice site probably null
R5847:Cnot2 UTSW 10 116527946 missense probably damaging 0.98
R6444:Cnot2 UTSW 10 116499355 missense probably benign 0.02
R6734:Cnot2 UTSW 10 116498153 missense possibly damaging 0.81
R6735:Cnot2 UTSW 10 116498153 missense possibly damaging 0.81
R6944:Cnot2 UTSW 10 116537223 intron probably benign
R7139:Cnot2 UTSW 10 116495019 missense probably benign 0.00
R7248:Cnot2 UTSW 10 116498373 missense probably benign 0.05
R7423:Cnot2 UTSW 10 116492398 missense probably damaging 1.00
R7526:Cnot2 UTSW 10 116507080 missense probably benign 0.12
R7851:Cnot2 UTSW 10 116537432 missense possibly damaging 0.66
R8245:Cnot2 UTSW 10 116510389 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AAGTCTGAGGCTCTCTGTGG -3'
(R):5'- AAGGGGATCCAGGTGTTACC -3'

Sequencing Primer
(F):5'- GGATAACACCTATAATGCCTGCCTG -3'
(R):5'- TGGGACTCCATAAATATGTCAGAG -3'
Posted On2018-08-01