Incidental Mutation 'R6733:Zkscan6'
ID530152
Institutional Source Beutler Lab
Gene Symbol Zkscan6
Ensembl Gene ENSMUSG00000018347
Gene Namezinc finger with KRAB and SCAN domains 6
Synonyms1700128E15Rik, Zfp535, KOX11, D11Ertd714e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R6733 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location65807175-65829239 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65828635 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 494 (T494A)
Ref Sequence ENSEMBL: ENSMUSP00000071406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018491] [ENSMUST00000071465] [ENSMUST00000080665]
Predicted Effect probably damaging
Transcript: ENSMUST00000018491
AA Change: T494A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000018491
Gene: ENSMUSG00000018347
AA Change: T494A

DomainStartEndE-ValueType
SCAN 37 149 2.75e-57 SMART
KRAB 223 280 4.18e-3 SMART
ZnF_C2H2 415 437 1.08e-1 SMART
ZnF_C2H2 443 465 4.72e-2 SMART
ZnF_C2H2 471 493 1.67e-2 SMART
ZnF_C2H2 499 521 4.94e-5 SMART
ZnF_C2H2 527 549 1.72e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000071465
AA Change: T494A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000071406
Gene: ENSMUSG00000018347
AA Change: T494A

DomainStartEndE-ValueType
SCAN 37 149 2.75e-57 SMART
KRAB 223 280 4.18e-3 SMART
ZnF_C2H2 415 437 1.08e-1 SMART
ZnF_C2H2 443 465 4.72e-2 SMART
ZnF_C2H2 471 493 1.67e-2 SMART
ZnF_C2H2 499 521 4.94e-5 SMART
ZnF_C2H2 527 549 1.72e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000080665
SMART Domains Protein: ENSMUSP00000079494
Gene: ENSMUSG00000056752

DomainStartEndE-ValueType
Pfam:DHC_N1 209 787 3.6e-164 PFAM
coiled coil region 788 820 N/A INTRINSIC
low complexity region 1228 1240 N/A INTRINSIC
Pfam:DHC_N2 1290 1699 1.4e-134 PFAM
AAA 1863 1999 4.9e-1 SMART
AAA 2141 2341 1.99e0 SMART
AAA 2468 2614 6.75e-1 SMART
Pfam:AAA_8 2786 3053 1.1e-165 PFAM
Pfam:MT 3065 3408 7.2e-208 PFAM
Pfam:AAA_9 3430 3652 3.2e-87 PFAM
Pfam:Dynein_heavy 3786 4482 1e-241 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152386
SMART Domains Protein: ENSMUSP00000116499
Gene: ENSMUSG00000056752

DomainStartEndE-ValueType
Pfam:AAA_7 1 258 3e-155 PFAM
Pfam:AAA_8 336 603 3.9e-166 PFAM
Pfam:MT 615 958 2.3e-208 PFAM
Pfam:AAA_9 980 1202 1.1e-87 PFAM
Pfam:Dynein_heavy 1336 1514 2.4e-52 PFAM
Pfam:Dynein_heavy 1508 1956 8.6e-155 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,930,530 S155P probably damaging Het
Afdn C T 17: 13,823,353 H358Y probably benign Het
Ccdc125 T A 13: 100,694,487 M394K probably benign Het
Cfd C A 10: 79,891,802 H103Q probably damaging Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Dedd2 T C 7: 25,203,907 E209G probably benign Het
Dnah3 A G 7: 119,922,974 S3999P probably benign Het
Fer1l5 T C 1: 36,408,672 probably null Het
H6pd A T 4: 149,985,121 probably null Het
Il25 T C 14: 54,933,033 I21T probably benign Het
Kmt2c C T 5: 25,409,293 S143N probably damaging Het
Marveld3 T C 8: 109,962,049 D20G possibly damaging Het
Msl1 A G 11: 98,800,056 E122G probably damaging Het
Obscn A T 11: 59,028,595 V6861E probably damaging Het
Olfr1447 A T 19: 12,901,241 C180S probably damaging Het
Phc1 A T 6: 122,336,886 M29K possibly damaging Het
Pkd1l3 T A 8: 109,648,494 probably null Het
Prl5a1 G T 13: 28,149,936 V141F possibly damaging Het
Psg20 A T 7: 18,674,622 V391D probably damaging Het
Ptprh T C 7: 4,603,044 probably null Het
Rasa3 T C 8: 13,580,037 E580G possibly damaging Het
Ror1 T C 4: 100,426,055 V439A probably benign Het
Rsl1 A G 13: 67,177,142 T81A probably benign Het
Sgpp1 G C 12: 75,735,469 P32R probably benign Het
Slc22a8 T C 19: 8,609,292 L389P probably benign Het
Slc6a11 A G 6: 114,134,898 Y142C probably damaging Het
Syt9 C T 7: 107,425,296 T132I probably damaging Het
Thop1 T A 10: 81,081,412 I583N probably damaging Het
Tom1l1 A G 11: 90,685,060 probably null Het
Unk A G 11: 116,050,755 D276G probably damaging Het
Zfp942 C A 17: 21,928,752 E299* probably null Het
Zscan25 T A 5: 145,290,913 probably null Het
Other mutations in Zkscan6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Zkscan6 APN 11 65828461 missense possibly damaging 0.96
IGL00941:Zkscan6 APN 11 65814747 missense probably damaging 1.00
IGL01784:Zkscan6 APN 11 65814721 missense probably damaging 1.00
IGL02423:Zkscan6 APN 11 65828294 missense probably benign 0.00
IGL03001:Zkscan6 APN 11 65814669 missense probably damaging 1.00
R0105:Zkscan6 UTSW 11 65821985 missense probably damaging 1.00
R0105:Zkscan6 UTSW 11 65821985 missense probably damaging 1.00
R0112:Zkscan6 UTSW 11 65814863 splice site probably benign
R0542:Zkscan6 UTSW 11 65828699 missense possibly damaging 0.92
R1636:Zkscan6 UTSW 11 65814430 start gained probably benign
R2235:Zkscan6 UTSW 11 65828272 missense probably benign 0.00
R3926:Zkscan6 UTSW 11 65828225 missense probably benign
R6083:Zkscan6 UTSW 11 65815931 missense probably damaging 1.00
R6277:Zkscan6 UTSW 11 65828157 missense probably benign 0.00
R6558:Zkscan6 UTSW 11 65828225 missense probably benign
R7301:Zkscan6 UTSW 11 65828225 missense probably benign
R7432:Zkscan6 UTSW 11 65814363 critical splice acceptor site probably null
R7466:Zkscan6 UTSW 11 65828531 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGAGAGTGTGGGAAAACCTTC -3'
(R):5'- CCAAGTGTGATCTCTGATGCTTG -3'

Sequencing Primer
(F):5'- CACAGCTTGTTTTTCACCAAAGGAC -3'
(R):5'- ATCTCTGATGCTTGTCAAGGC -3'
Posted On2018-08-01