Incidental Mutation 'R6733:Tom1l1'
ID530153
Institutional Source Beutler Lab
Gene Symbol Tom1l1
Ensembl Gene ENSMUSG00000020541
Gene Nametarget of myb1-like 1 (chicken)
Synonyms2310045L10Rik, Srcasm
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R6733 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location90643465-90688366 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 90685060 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020849] [ENSMUST00000107868] [ENSMUST00000107869] [ENSMUST00000154599]
Predicted Effect probably null
Transcript: ENSMUST00000020849
SMART Domains Protein: ENSMUSP00000020849
Gene: ENSMUSG00000020541

DomainStartEndE-ValueType
VHS 15 150 7.37e-53 SMART
Pfam:GAT 212 288 5.8e-17 PFAM
low complexity region 340 349 N/A INTRINSIC
low complexity region 409 416 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107868
SMART Domains Protein: ENSMUSP00000103500
Gene: ENSMUSG00000020541

DomainStartEndE-ValueType
Pfam:VHS 1 73 4.2e-10 PFAM
Pfam:GAT 119 220 5.5e-29 PFAM
low complexity region 263 272 N/A INTRINSIC
low complexity region 332 339 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107869
SMART Domains Protein: ENSMUSP00000103501
Gene: ENSMUSG00000020541

DomainStartEndE-ValueType
VHS 15 152 7.23e-38 SMART
low complexity region 264 273 N/A INTRINSIC
low complexity region 333 340 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131055
Predicted Effect probably null
Transcript: ENSMUST00000154599
SMART Domains Protein: ENSMUSP00000123329
Gene: ENSMUSG00000020541

DomainStartEndE-ValueType
VHS 15 150 7.37e-53 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,930,530 S155P probably damaging Het
Afdn C T 17: 13,823,353 H358Y probably benign Het
Ccdc125 T A 13: 100,694,487 M394K probably benign Het
Cfd C A 10: 79,891,802 H103Q probably damaging Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Dedd2 T C 7: 25,203,907 E209G probably benign Het
Dnah3 A G 7: 119,922,974 S3999P probably benign Het
Fer1l5 T C 1: 36,408,672 probably null Het
H6pd A T 4: 149,985,121 probably null Het
Il25 T C 14: 54,933,033 I21T probably benign Het
Kmt2c C T 5: 25,409,293 S143N probably damaging Het
Marveld3 T C 8: 109,962,049 D20G possibly damaging Het
Msl1 A G 11: 98,800,056 E122G probably damaging Het
Obscn A T 11: 59,028,595 V6861E probably damaging Het
Olfr1447 A T 19: 12,901,241 C180S probably damaging Het
Phc1 A T 6: 122,336,886 M29K possibly damaging Het
Pkd1l3 T A 8: 109,648,494 probably null Het
Prl5a1 G T 13: 28,149,936 V141F possibly damaging Het
Psg20 A T 7: 18,674,622 V391D probably damaging Het
Ptprh T C 7: 4,603,044 probably null Het
Rasa3 T C 8: 13,580,037 E580G possibly damaging Het
Ror1 T C 4: 100,426,055 V439A probably benign Het
Rsl1 A G 13: 67,177,142 T81A probably benign Het
Sgpp1 G C 12: 75,735,469 P32R probably benign Het
Slc22a8 T C 19: 8,609,292 L389P probably benign Het
Slc6a11 A G 6: 114,134,898 Y142C probably damaging Het
Syt9 C T 7: 107,425,296 T132I probably damaging Het
Thop1 T A 10: 81,081,412 I583N probably damaging Het
Unk A G 11: 116,050,755 D276G probably damaging Het
Zfp942 C A 17: 21,928,752 E299* probably null Het
Zkscan6 A G 11: 65,828,635 T494A probably damaging Het
Zscan25 T A 5: 145,290,913 probably null Het
Other mutations in Tom1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Tom1l1 APN 11 90674740 missense probably damaging 1.00
IGL01995:Tom1l1 APN 11 90649861 missense probably damaging 0.96
R0057:Tom1l1 UTSW 11 90685149 splice site probably benign
R1557:Tom1l1 UTSW 11 90656384 missense possibly damaging 0.92
R1614:Tom1l1 UTSW 11 90683254 missense probably damaging 1.00
R1616:Tom1l1 UTSW 11 90656351 missense possibly damaging 0.92
R2165:Tom1l1 UTSW 11 90649895 splice site probably benign
R2517:Tom1l1 UTSW 11 90671125 missense possibly damaging 0.66
R3745:Tom1l1 UTSW 11 90657741 missense probably benign 0.01
R4614:Tom1l1 UTSW 11 90671126 missense probably damaging 1.00
R4694:Tom1l1 UTSW 11 90646849 missense possibly damaging 0.86
R4755:Tom1l1 UTSW 11 90685116 missense probably damaging 1.00
R5397:Tom1l1 UTSW 11 90661774 missense probably benign 0.02
R6294:Tom1l1 UTSW 11 90661761 nonsense probably null
R6911:Tom1l1 UTSW 11 90644161 splice site probably null
R7103:Tom1l1 UTSW 11 90671081 splice site probably null
R7489:Tom1l1 UTSW 11 90656359 missense probably benign 0.00
R7696:Tom1l1 UTSW 11 90672915 missense probably benign 0.02
R8244:Tom1l1 UTSW 11 90657821 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- AAGCTCTAATGACCTCTTGGG -3'
(R):5'- GTACTTGTTCGTGCACCCTG -3'

Sequencing Primer
(F):5'- TCTTGGGGTCCCCTGCATG -3'
(R):5'- CCCAAGCAGATTATTTCAAGGACATG -3'
Posted On2018-08-01